DYRK1A (NM_001396) Human Untagged Clone
CAT#: SC314641
DYRK1A (untagged)-Human dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A (DYRK1A), transcript variant 1
CNY 8392.00
Cited in 1 publication. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DYRK; DYRK1; HP86; MNB; MNBH; MRD7 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001396 edited
AGGAAGCGGCGCGAGCGCCCCGCCATCGTCCCGTGTTATAGTTTTGCCGCTGGACTCTTCCCTCCCTTCC CCCACCCCATCAGGATGATATGAGACTTGAAAGAAGACGATGCATACAGGAGGAGAGACTTCAGCATGCA AACCTTCATCTGTTCGGCTTGCACCGTCATTTTCATTCCATGCTGCTGGCCTTCAGATGGCTGGACAGAT GCCCCATTCACATCAGTACAGTGACCGTCGCCAGCCAAACATAAGTGACCAACAGGTTTCTGCCTTATCA TATTCTGACCAGATTCAGCAACCTCTAACTAACCAGGTGATGCCTGATATT:GTCATGTTACAGAGGCGG ATGCCCCAAACCTTCCGTGACCCAGCAACTGCTCCCCTGAGAAAACTTTCTGTTGACTTGATCAAAACAT ACAAGCATATTAATGAGGTTTACTATGCAAAAAAGAAGCGAAGACACCAACAGGGCCAGGGAGACGATTC TAGTCATAAGAAGGAACGGAAGGTTTACAATGATGGTTATGATGATGATAACTATGATTATATTGTAAAA AACGGAGAAAAGTGGATGGATCGTTACGAAATTGACTCCTTGATAGGCAAAGGTTCCTTTGGACAGGTTG TAAAGGCATATGATCGTGTGGAGCAAGAATGGGTTGCCATTAAAATAATAAAGAACAAGAAGGCTTTTCT GAATCAAGCACAGATAGAAGTGCGACTTCTTGAGCTCATGAACAAACATGACACTGAAATGAAATACTAC ATAGTGCATTTGAAACGCCACTTTATGTTTCGAAACCATCTCTGTTTAGTTTTTGAAATGCTGTCCTACA ACCTCTATGACTTGCTGAGAAACACCAATTTCCGAGGGGTCTCTTTGAACCTAACACGAAAGTTTGCGCA ACAGATGTGCACTGCACTGCTTTTCCTTGCGACTCCAGAACTTAGTATCATTCACTGTGATCTAAAACCT GAAAATATCCTTCTTTGTAACCCCAAACGCAGTGCAATCAAGATAGTTGACTTTGGCAGTTCTTGTCAGT TGGGGCAGAGGATATACCAGTATATTCAGAGTCGCTTTTATCGGTCTCCAGAGGTGCTACTGGGAATGCC TTATGACCTTGCCATTGATATGTGGTCCCTCGGGTGTATTTTGGTTGAAATGCACACTGGAGAACCTCTG TTCAGTGGTGCCAATGAGGTAGATCAGATGAATAAAATAGTGGAAGTTCTGGGTATTCCACCTGCTCATA TTCTTGACCAAGCACCAAAAGCAAGAAAGTTCTTTGAGAAGTTGCCAGATGGCACTTGGAACTTAAAGAA GACCAAAGATGGAAAACGGGAGTACAAACCACCAGGAACCCGTAAACTTCATAACATTCTTGGAGTGGAA ACAGGAGGACCTGGTGGGCGACGTGCTGGGGAGTCAGGTCATACGGTCGCTGACTACTTGAAGTTCAAAG ACCTCATTTTAAGGATGCTTGATTATGACCCCAAAACTCGAATTCAACCTTATTATGCTCTGCAGCACAG TTTCTTCAAGAAAACAGCTGATGAAGGTACAAATACAAGTAATAGTGTATCTACAAGCCCCGCCATGGAG CAGTCTCAGTCTTCGGGCACCACCTCCAGTACATCGTCAAGCTCAGGTGGCTCATCGGGGACAAGCAACA GTGGGAGAGCCCGGTCGGATCCGACGCACCAGCATCGGCACAGTGGTGGGCACTTCACAGCTGCCGTGCA GGCCATGGACTGCGAGACACACAGTCCCCAGGTGCGTCAGCAATTTCCTGCTCCTCTTGGTTGGTCAGGC ACTGAAGCTCCTACACAGGTCACTGTTGAAACTCATCCTGTTCAAGAAACAACCTTTCATGTAGCCCCTC AACAGAATGCATTGCATCATCACCATGGTAACAGTTCCCATCACCATCACCACCACCACCACCATCACCA CCACCATGGACAACAAGCCTTGGGTAACCGGACCAGGCCAAGGGTCTACAATTCTCCAACGAATAGCTCC TCTACCCAAGATTCTATGGAGGTTGGCCACAGTCACCACTCCATGACATCCCTGTCTTCCTCAACGACTT CTTCCTCGACATCTTCCTCCTCTACTGGTAACCAAGGCAATCAGGCCTACCAGAATCGCCCAGTGGCTGC TAATACCTTGGACTTTGGACAGAATGGAGCTATGGACGTTAATTTGACCGTCTACTCCAATCCCCGCCAA GAGACTGGCATAGCTGGACATCCAACATACCAATTTTCTGCTAATACAGGTCCTGCACATTACATGACTG AAGGACATCTGACAATGAGGCAAGGGGCTGATAGAGAAGAGTCCCCCATGACAGGAGTTTGTGTGCAACA GAGTCCTGTAGCTAGCTCGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001396 |
Insert Size | 2400 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. This clone may be unstable or toxic at high copy number in common E. coli strain. We recommend using a lower copy number E. coli strain, such as CopyCutter strain (http://www.epibio.com/item.asp?ID=435) for transformation and plasmid preparation. Please be aware that the DNA yield could be low. Additional aliquots of this clone can be ordered from OriGene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001396.2, NP_001387.2 |
RefSeq Size | 5010 bp |
RefSeq ORF | 2292 bp |
Locus ID | 1859 |
UniProt ID | Q13627 |
Domains | pkinase, TyrKc, S_TKc |
Protein Families | Druggable Genome, Protein Kinase |
Gene Summary | This gene encodes a member of the Dual-specificity tyrosine phosphorylation-regulated kinase (DYRK) family. This member contains a nuclear targeting signal sequence, a protein kinase domain, a leucine zipper motif, and a highly conservative 13-consecutive-histidine repeat. It catalyzes its autophosphorylation on serine/threonine and tyrosine residues. It may play a significant role in a signaling pathway regulating cell proliferation and may be involved in brain development. This gene is a homolog of Drosophila mnb (minibrain) gene and rat Dyrk gene. It is localized in the Down syndrome critical region of chromosome 21, and is considered to be a strong candidate gene for learning defects associated with Down syndrome. Alternative splicing of this gene generates several transcript variants differing from each other either in the 5' UTR or in the 3' coding region. These variants encode at least five different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Impact of DYRK1A Expression on TNNT2 Splicing and Daunorubicin Toxicity in Human iPSC-Derived Cardiomyocytes
,null,
Cardiovascular Toxicology
,PubMed ID 35596909
[DYRK1A]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212584 | DYRK1A (Myc-DDK-tagged)-Human dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A (DYRK1A), transcript variant 1 |
CNY 5800.00 |
|
RC212584L1 | Lenti-ORF clone of DYRK1A (Myc-DDK-tagged)-Human dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A (DYRK1A), transcript variant 1 |
CNY 10784.00 |
|
RC212584L2 | Lenti-ORF clone of DYRK1A (mGFP-tagged)-Human dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A (DYRK1A), transcript variant 1 |
CNY 7700.00 |
|
RC212584L3 | Lenti-ORF clone of DYRK1A (Myc-DDK-tagged)-Human dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A (DYRK1A), transcript variant 1 |
CNY 7700.00 |
|
RC212584L4 | Lenti-ORF clone of DYRK1A (mGFP-tagged)-Human dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A (DYRK1A), transcript variant 1 |
CNY 10784.00 |
|
RG212584 | DYRK1A (tGFP-tagged) - Human dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A (DYRK1A), transcript variant 1 |
CNY 9984.00 |