Pyruvate Kinase (PKLR) (NM_181871) Human Untagged Clone
CAT#: SC313931
PKLR (untagged)-Human pyruvate kinase, liver and RBC (PKLR), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 8740.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PK1; PKL; PKRL; RPK |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_181871, the custom clone sequence may differ by one or more nucleotides
ATGGAAGGGCCAGCGGGGTATCTGCGGCGGGCCAGTGTGGCCCAACTGACCCAGGAGCTG GGCACTGCCTTCTTCCAGCAGCAGCAGCTGCCAGCTGCTATGGCAGACACCTTCCTGGAA CACCTCTGCCTACTGGACATTGACTCCGAGCCCGTGGCTGCTCGCAGTACCAGCATCATT GCCACCATCGGGCCAGCATCTCGCTCCGTGGAGCGCCTCAAGGAGATGATCAAGGCCGGG ATGAACATTGCGCGACTCAACTTCTCCCACGGCTCCCACGAGTACCATGCTGAGTCCATC GCCAACGTCCGGGAGGCGGTGGAGAGCTTTGCAGGTTCCCCACTCAGCTACCGGCCCGTG GCCATCGCCCTGGACACCAAGGGACCGGAGATCCGCACTGGGATCCTGCAGGGGGGTCCA GAGTCGGAAGTGGAGCTGGTGAAGGGCTCCCAGGTGCTGGTGACTGTGGACCCCGCGTTC CGGACGCGGGGGAACGCGAACACCGTGTGGGTGGACTACCCCAATATTGTCCGGGTCGTG CCGGTGGGGGGCCGCATCTACATTGACGACGGGCTCATCTCCCTAGTGGTCCAGAAAATC GGCCCAGAGGGACTGGTGACCCAAGTGGAGAACGGCGGCGTCCTGGGCAGCCGGAAGGGC GTGAACTTGCCAGGGGCCCAGGTGGACTTGCCCGGGCTGTCCGAGCAGGACGTCCGAGAC CTGCGCTTCGGGGTGGAGCATGGGGTGGACATCGTCTTTGCCTCCTTTGTGCGGAAAGCC AGCGACGTGGCTGCCGTCAGGGCTGCTCTGGGTCCGGAAGGACACGGCATCAAGATCATC AGCAAAATTGAGAACCACGAAGGCGTGAAGAGGTTTGATGAAATCCTGGAGGTGAGCGAC GGCATCATGGTGGCACGGGGGGACCTAGGCATCGAGATCCCAGCAGAGAAGGTTTTCCTG GCTCAGAAGATGATGATTGGGCGCTGCAACTTGGCGGGCAAGCCTGTTGTCTGTGCCACA CAGATGCTGGAGAGCATGATTACCAAGCCCCGGCCAACGAGGGCAGAGACAAGCGATGTC GCCAATGCTGTGCTGGATGGGGCTGACTGCATCATGCTGTCAGGGGAGACTGCCAAGGGC AACTTCCCTGTGGAAGCGGTGAAGATGCAGCATGCGATTGCCCGGGAGGCAGAGGCCGCA GTGTACCACCGGCAGCTGTTTGAGGAGCTACGTCGGGCAGCGCCACTAAGCCGTGATCCC ACTGAGGTCACCGCCATTGGTGCTGTGGAGGCTGCCTTCAAGTGCTGTGCTGCTGCCATC ATTGTGCTGACCACAACTGGCCGCTCAGCCCAGCTTCTGTCTCGGTACCGACCTCGGGCA GCAGTCATTGCTGTCACCCGCTCTGCCCAGGCTGCCCGCCAGGTCCACTTATGCCGAGGA GTCTTCCCCTTGCTTTACCGTGAACCTCCAGAAGCCATCTGGGCAGATGATGTAGATCGC CGGGTGCAATTTGGCATTGAAAGTGGAAAGCTCCGTGGCTTCCTCCGTGTTGGAGACCTG GTGATTGTGGTGACAGGCTGGCGACCTGGCTCCGGCTACACCAACATCATGCGGGTGCTA AGCATATCC |
| Restriction Sites | Please inquire |
| ACCN | NM_181871 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_181871.1, NP_870986.1 |
| RefSeq Size | 2433 bp |
| RefSeq ORF | 1632 bp |
| Locus ID | 5313 |
| UniProt ID | P30613 |
| Protein Families | Druggable Genome |
| Protein Pathways | Glycolysis / Gluconeogenesis, Insulin signaling pathway, Maturity onset diabetes of the young, Metabolic pathways, Purine metabolism, Pyruvate metabolism, Type II diabetes mellitus |
| Gene Summary | The protein encoded by this gene is a pyruvate kinase that catalyzes the transphosphorylation of phohsphoenolpyruvate into pyruvate and ATP, which is the rate-limiting step of glycolysis. Defects in this enzyme, due to gene mutations or genetic variations, are the common cause of chronic hereditary nonspherocytic hemolytic anemia (CNSHA or HNSHA). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate 5' exon, as compared to variant 1. The resulting isoform (2) has a distinct and shorter N-terminus, as compared to isoform 1. Isoform 2 is also known as type L. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212337 | PKLR (Myc-DDK-tagged)-Human pyruvate kinase, liver and RBC (PKLR), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 6064.00 |
|
| RC212337L1 | Lenti-ORF clone of PKLR (Myc-DDK-tagged)-Human pyruvate kinase, liver and RBC (PKLR), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 6650.00 |
|
| RC212337L2 | Lenti-ORF clone of PKLR (mGFP-tagged)-Human pyruvate kinase, liver and RBC (PKLR), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 8464.00 |
|
| RC212337L3 | Lenti-ORF clone of PKLR (Myc-DDK-tagged)-Human pyruvate kinase, liver and RBC (PKLR), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 6650.00 |
|
| RC212337L4 | Lenti-ORF clone of PKLR (mGFP-tagged)-Human pyruvate kinase, liver and RBC (PKLR), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 8464.00 |
|
| RG212337 | PKLR (tGFP-tagged) - Human pyruvate kinase, liver and RBC (PKLR), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 7664.00 |
其它Pyruvate Kinase产品
