C6orf150 (MB21D1) (NM_138441) Human Untagged Clone

CAT#: SC313843

MB21D1 (untagged)-Human Mab-21 domain containing 1 (MB21D1)



  "NM_138441" in other vectors (6)

CNY 5840.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
cGAS Rabbit polyclonal Antibody
    • 100 ul

CNY 2350.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C6orf150; h-cGAS; MB21D1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC313843 representing NM_138441
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGCCTTGGCACGGAAAGGCCATGCAGAGAGCTTCCGAGGCCGGAGCCACTGCCCCCAAGGCTTCCG
CACGGAATGCCAGGGGCGCCCCGATGGATCCCAACGAGTCTCCGGCTGCCCCCGAGGCCGCCCTGCCTAA
GGCGGGAAAGTTCGGCCCCGCCAGGAAGTCGGGATCCCGGCAGAAAAAGAGCGCCCCGGACACCCAGGAG
AGGCCGCCCGTCCGCGCAACTGGGGCCCGCGCCAAAAAGGCCCCTCAGCGCGCCCAGGACACGCAGCCGT
CTGACGCCACCAGCGCCCCTGGGGCAGAGGGGCTGGAGCCTCCTGCGGCTCGGGAGCCGGCTCTTTCCAG
GGCTGGTTCTTGCCGCCAGAGGGGCGCGCGCTGCTCCACGAAGCCAAGACCCCCGCCCGGGCCCTGGGAC
GTGCCCAGCCCCGGCCTGCCGGTCTCGGCCCCCATTCTCGTACGGAGGGATGCGGCGCCTGGGGCCTCGA
AGCTCCGGGCGGTTTTGGAGAAGTTGAAGCTCAGCCGCGATGATATCTCCACGGCGGCGGGGATGGTGAA
AGGGGTTGTGGACCACCTGCTGCTCAGACTGAAGTGCGACTCCGCGTTCAGAGGCGTCGGGCTGCTGAAC
ACCGGGAGCTACTATGAGCACGTGAAGATTTCTGCACCTAATGAATTTGATGTCATGTTTAAACTGGAAG
TCCCCAGAATTCAACTAGAAGAATATTCCAACACTCGTGCATATTACTTTGTGAAATTTAAAAGAAATCC
GAAAGAAAATCATCTGAGTCAGTTTTTAGAAGGTGAAATATTATCAGCTTCTAAGATGCTGTCAAAGTTT
AGGAAAATCATTAAGGAAGAAATTAACGACATTAAAGATACAGATGTCATCATGAAGAGGAAAAGAGGAG
GGAGCCCTGCTGTAACACTTCTTATTAGTGAAAAAATATCTGTGGATATAACCCTGGCTTTGGAATCAAA
AAGTAGCTGGCCTGCTAGCACCCAAGAAGGCCTGCGCATTCAAAACTGGCTTTCAGCAAAAGTTAGGAAG
CAACTACGACTAAAGCCATTTTACCTTGTACCCAAGCATGCAAAGGAAGGAAATGGTTTCCAAGAAGAAA
CATGGCGGCTATCCTTCTCTCACATCGAAAAGGAAATTTTGAACAATCATGGAAAATCTAAAACGTGCTG
TGAAAACAAAGAAGAGAAATGTTGCAGGAAAGATTGTTTAAAACTAATGAAATACCTTTTAGAACAGCTG
AAAGAAAGGTTTAAAGACAAAAAACATCTGGATAAATTCTCTTCTTATCATGTGAAAACTGCCTTCTTTC
ACGTATGTACCCAGAACCCTCAAGACAGTCAGTGGGACCGCAAAGACCTGGGCCTCTGCTTTGATAACTG
CGTGACATACTTTCTTCAGTGCCTCAGGACAGAAAAACTTGAGAATTATTTTATTCCTGAATTCAATCTA
TTCTCTAGCAACTTAATTGACAAAAGAAGTAAAGAATTTCTGACAAAGCAAATTGAATATGAAAGAAACA
ATGAGTTTCCAGTTTTTGATGAATTTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites Please inquire     
ACCN NM_138441
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_138441.1, NP_612450.1
RefSeq Size 1888 bp
RefSeq ORF 1569 bp
Locus ID 115004
UniProt ID Q8N884
Gene Summary Nucleotidyltransferase that catalyzes the formation of cyclic GMP-AMP (cGAMP) from ATP and GTP and plays a key role in innate immunity (PubMed:23258413, PubMed:23707061, PubMed:23722159, PubMed:24077100, PubMed:25131990, PubMed:29976794, PubMed:30799039). Catalysis involves both the formation of a 2',5' phosphodiester linkage at the GpA step and the formation of a 3',5' phosphodiester linkage at the ApG step, producing c[G(2',5')pA(3',5')p] (PubMed:28363908, PubMed:28214358). Acts as a key cytosolic DNA sensor, the presence of double-stranded DNA (dsDNA) in the cytoplasm being a danger signal that triggers the immune responses (PubMed:28363908). Binds cytosolic DNA directly, leading to activation and synthesis of cGAMP, a second messenger that binds to and activates TMEM173/STING, thereby triggering type-I interferon production (PubMed:28363908, PubMed:28314590). Preferentially recognizes and binds curved long DNAs (PubMed:30007416). In contrast to other mammals, human CGAS displays species-specific mechanisms of DNA recognition and produces less cyclic GMP-AMP (cGAMP), allowing a more fine-tuned response to pathogens (PubMed:30007416). Has antiviral activity by sensing the presence of dsDNA from DNA viruses in the cytoplasm (PubMed:28363908). Also acts as an innate immune sensor of infection by retroviruses, such as HIV-1, by detecting the presence of reverse-transcribed DNA in the cytosol (PubMed:23929945). Detection of retroviral reverse-transcribed DNA in the cytosol may be indirect and be mediated via interaction with PQBP1, which directly binds reverse-transcribed retroviral DNA (PubMed:26046437). Also detects the presence of DNA from bacteria, such as M.tuberculosis (PubMed:26048138). cGAMP can be transferred from producing cells to neighboring cells through gap junctions, leading to promote TMEM173/STING activation and convey immune response to connecting cells (PubMed:24077100). cGAMP can also be transferred between cells by virtue of packaging within viral particles contributing to IFN-induction in newly infected cells in a cGAS-independent but TMEM173/STING-dependent manner (PubMed:26229115). In addition to antiviral activity, also involved in the response to cellular stresses, such as senescence, DNA damage or genome instability (PubMed:28738408, PubMed:28759889). Acts as a regulator of cellular senescence by binding to cytosolic chromatin fragments that are present in senescent cells, leading to trigger type-I interferon production via TMEM173/STING and promote cellular senescence (By similarity). Also involved in the inflammatory response to genome instability and double-stranded DNA breaks: acts by localizing to micronuclei arising from genome instability (PubMed:28738408, PubMed:28759889). Micronuclei, which as frequently found in cancer cells, consist of chromatin surrounded by its own nuclear membrane: following breakdown of the micronuclear envelope, a process associated with chromothripsis, CGAS binds self-DNA exposed to the cytosol, leading to cGAMP synthesis and subsequent activation of TMEM173/STING and type-I interferon production (PubMed:28738408, PubMed:28759889). Acts as a suppressor of DNA repair in response to DNA damage: translocates to the nucleus following dephosphorylation at Tyr-215 and inhibits homologous recombination repair by interacting with PARP1, the CGAS-PARP1 interaction leading to impede the formation of the PARP1-TIMELESS complex (PubMed:30356214).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...