SETD4 (NM_017438) Human Untagged Clone
CAT＃: SC313482
SETD4 (untagged)-Human SET domain containing 4 (SETD4), transcript variant 1
CNY 5488.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C21orf18; C21orf27 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_017438, the custom clone sequence may differ by one or more nucleotides
ATGCAGAAAGGAAAAGGGAGAACAAGCCGGATCAGAAGACGAAAACTCTGCGGAAGTTCTGAATCAAGAG GAGTGAATGAGAGCCACAAGTCTGAATTTATAGAGCTGAGGAAGTGGCTGAAAGCTAGGAAGTTTCAAGA TTCAAACTTAGCGCCTGCTTGTTTTCCAGGTACAGGAAGAGGGCTGATGAGTCAAACATCCCTGCAGGAG GGACAGATGATTATTTCGTTGCCTGAGAGTTGCCTGCTCACCACGGACACAGTGATTCGAAGCTACTTAG GGGCATACATTACTAAGTGGAAGCCTCCTCCATCTCCTCTGCTGGCGCTGTGCACCTTTTTAGTTTCAGA AAAGCATGCTGGGCACCGATCTCTTTGGAAGCCTTACCTGGAGATTTTACCCAAGGCGTATACCTGCCCT GTTTGTTTGGAGCCGGAAGTGGTGAACCTTCTTCCCAAATCTTTAAAAGCAAAGGCTGAAGAGCAGAGAG CCCACGTGCAGGAGTTCTTTGCTTCCTCCAGAGACTTTTTCTCTTCTCTGCAGCCTCTGTTTGCGGAGGC TGTTGACAGCATCTTCAGCTACAGTGCCCTGCTGTGGGCTTGGTGCACCGTCAACACCAGAGCCGTGTAC CTGAGGCCCAGGCAGCGGGAATGCCTTTCTGCAGAGCCGGACACCTGTGCACTCGCTCCGTACCTGGACC TGCTGAATCATAGCCCACATGTCCAGGTAAAAGCAGCGTTTAATGAAGAAACTCATTCTTACGAAATTAG AACGACTTCACGTTGGAGAAAGCATGAAGAGGTATTCATCTGTTACGGCCCTCACGATAATCAACGGCTG TTCCTGGAATACGGATTTGTTTCTGTCCATAATCCTCATGCTTGTGTTTATGTCTCAAGAGAAATACTTG TTAAATATCTTCCATCAACAGATAAACAGATGGACAAAAAGATTTCTATTTTAAAGGATCATGGCTATAT AGAAAATTTGACATTTGGATGGGATGGACCATCTTGGAGGCTACTCACAGCCCTTAAGTTGTTATGTCTG GAAGCTGAGAAATTTACATGCTGGAAAAAAGTACTTCTTGGGGAGGTAATTTCAGATACGAATGAGAAGA CAAGTTTGGACATAGCCCAGAAAATATGCTATTATTTCATAGAAGAGACTAATGCTGTGCTTCAAAAGGT GTCTCATATGAAGGATGAAAAAGAGGCCCTGATAAACCAACTAACTTTGGTGGAATCCTTGTGGACGGAA GAGCTAAAGATTCTCAGGGCATCTGCCGAGACCCTGCACAGTTTGCAAACAGCTTTTACCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_017438 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_017438.2, NP_059134.1 |
| RefSeq Size | 3360 bp |
| RefSeq ORF | 1323 bp |
| Locus ID | 54093 |
| UniProt ID | Q9NVD3 |
| Domains | SET |
| Gene Summary | Histone-lysine N-methyltransferase that acts as a regulator of cell proliferation, cell differentiation and inflammatory response (PubMed:31308046). Regulates the inflammatory response by mediating mono- and dimethylation of 'Lys-4' of histone H3 (H3K4me1 and H3K4me2, respectively), leading to activate the transcription of proinflammatory cytokines IL6 and TNF-alpha (By similarity). Also involved in the regulation of stem cell quiescence by catalyzing the trimethylation of 'Lys-20' of histone H4 (H4K20me3), thereby promoting heterochromatin formation (PubMed:31308046). Involved in proliferation, migration, paracrine and myogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212740 | SETD4 (Myc-DDK-tagged)-Human SET domain containing 4 (SETD4), transcript variant 1 |
CNY 5488.00 |
|
| RC212740L1 | Lenti ORF clone of Human SET domain containing 4 (SETD4), transcript variant 1, Myc-DDK-tagged |
CNY 7888.00 |
|
| RC212740L2 | Lenti ORF clone of Human SET domain containing 4 (SETD4), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC212740L3 | Lenti ORF clone of Human SET domain containing 4 (SETD4), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC212740L4 | Lenti ORF clone of Human SET domain containing 4 (SETD4), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG212740 | SETD4 (tGFP-tagged) - Human SET domain containing 4 (SETD4), transcript variant 1 |
CNY 4370.00 |
