ZCCHC6 (BC032456) Human Untagged Clone

CAT#: SC313350

ZCCHC6 (untagged)-Homo sapiens, clone MGC:40478 IMAGE:5172299, complete cds



CNY 13400.00


货期*
6周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TUT7 Antibody - N-terminal region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DKFZp666B142; DKFZp686C11112; DKFZp686F119; DKFZp686I1269; PAP associated domain containing 6; PAPD6; zinc finger, CCHC domain containing 6
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for BC032456, the custom clone sequence may differ by one or more nucleotides
ATGGGAGATACAGCAAAACCTTATTTCGTGAAGCGCACTAAAGACCGGGGGACTATGGAT
GATGATGACTTCAGAAGGGGTCACCCCCAACAAGATTATTTAATAATAGATGACCATGCT
AAAGGCCATGGCAGTAAAATGGAAAAGGGCCTTCAAAAAAAGAAGATAACACCAGGGAAC
TATGGGAATACCCCCAGAAAAGGACCATGTGCTGTTTCCAGCAATCCATATGCATTTAAA
AACCCAATCTACAGTCAACCCGCTTGGATGAATGACAGCCACAAAGATCAGAGTAAGAGA
TGGCTGTCTGATGAACATACTGGTAATTCAGACAACTGGAGAGAATTCAAACCTGGACCT
AGAATTCCTGTTATAAACCGACAAAGAAAAGACTCCTTTCAAGAAAATGAAGATGGTTAT
AGGTGGCAAGACACAAGAGGCTGCAGAACTGTAAGACGACTGTTTCATAAAGACCTAACA
AGCCTAGAAACCACGTCAGAAATGGAAGCAGGAAGTCCTGAAAACAAGAAGCAGAGGTCC
AGACCTAGGAAGCCACGGAAGACTAGAAATGAGGAAAATGAGCAGGATGGAGACTTGGAA
GGCCCTGTGATCGATGAGTCTGTACTTTCAACGAAGGAGCTGCTAGGCTTACAGCAGGCT
GAGGAGAGACTGAAGAGAGACTGCATTGACAGGCTAAAAAGGCGACCACGAAACTACCCT
ACAGCAAAGTACACCTGCAGACTCTGTGATGTTTTAATTGAATCCATTGCATTTGCCCAT
AAGCATATCAAGGAAAAGAGGCACAAGAAAAACATTAAGGAGAAGCAAGAGGAAGAGTTG
CTCACTACGTTACCCCCACCAACACCCTCCCAGATAAATGCAGTTGGCATTGCCATTGAC
AAAGTGGTACAGGAATTTGGCTTACACAATGAGAACTTGGAACAGAGGCTGGAAATTAAA
CGTATCATGGAAAATGTGTTCCAACACAAGTTACCAGATTGTTCCCTAAGATTATATGGG
TCATCCTGTAGCAGATTGGGTTTCAAAAATTCGGATGTAAACATTGACATCCAGTTTCCA
GCCATTATGTCTCAGCCAGATGTCCTCTTACTTGTTCAAGAATGTTTAAAGAACAGTGAC
TCCTTTATTGATGTTGATGCAGACTTCCATGCTAGGGTGCCAGTGGTGGTGTGCAGAGAA
AAGCAAAGGTCTCATTTCTTTAAACTGTTTATTTAC
Restriction Sites Please inquire     
ACCN BC032456
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC032456.1, AAH32456.1
RefSeq Size 1614 bp
RefSeq ORF 1614 bp
Locus ID 79670
Domains ZnF_U1
Gene Summary Uridylyltransferase that mediates the terminal uridylation of mRNAs with short (less than 25 nucleotides) poly(A) tails, hence facilitating global mRNA decay (PubMed:19703396, PubMed:25480299). Essential for both oocyte maturation and fertility. Through 3' terminal uridylation of mRNA, sculpts, with TUT7, the maternal transcriptome by eliminating transcripts during oocyte growth (By similarity). Involved in microRNA (miRNA)-induced gene silencing through uridylation of deadenylated miRNA targets (PubMed:25480299). Also functions as an integral regulator of microRNA biogenesiS using 3 different uridylation mechanisms (PubMed:25979828). Acts as a suppressor of miRNA biogenesis by mediating the terminal uridylation of some miRNA precursors, including that of let-7 (pre-let-7). Uridylated pre-let-7 RNA is not processed by Dicer and undergo degradation. Pre-let-7 uridylation is strongly enhanced in the presence of LIN28A (PubMed:22898984). In the absence of LIN28A, TUT7 and TUT4 monouridylate group II pre-miRNAs, which includes most of pre-let7 members, that shapes an optimal 3' end overhang for efficient processing (PubMed:25979828, PubMed:28671666). Add oligo-U tails to truncated pre-miRNAS with a 5' overhang which may promote rapid degradation of non-functional pre-miRNA species (PubMed:25979828). Does not play a role in replication-dependent histone mRNA degradation (PubMed:18172165). Due to functional redundancy between TUT4 and TUT7, the identification of the specific role of each of these proteins is difficult (PubMed:25979828, PubMed:25480299, PubMed:19703396, PubMed:22898984, PubMed:18172165, PubMed:28671666). TUT4 and TUT7 restrict retrotransposition of long interspersed element-1 (LINE-1) in cooperation with MOV10 counteracting the RNA chaperonne activity of L1RE1. TUT7 uridylates LINE-1 mRNAs in the cytoplasm which inhibits initiation of reverse transcription once in the nucleus, whereas uridylation by TUT4 destabilizes mRNAs in cytoplasmic ribonucleoprotein granules (PubMed:30122351).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...