Cytohesin 1 (CYTH1) (NM_017456) Human Untagged Clone

CAT#: SC313294

CYTH1 (untagged)-Human cytohesin 1 (CYTH1), transcript variant 2



  "NM_017456" in other vectors (4)

CNY 7220.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-CYTH1 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B2-1; CYTOHESIN-1; D17S811E; PSCD1; SEC7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC313294 representing NM_017456.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGAGGACGACAGCTACGTTCCCAGTGACCTGACAGCAGAGGAGCGTCAAGAACTGGAGAACATC
CGACGGAGAAAACAGGAGCTGCTGGCTGACATTCAGAGGCTGAAGGATGAGATAGCAGAAGTAGCTAAT
GAAATTGAAAACCTGGGATCCACAGAGGAAAGGAAAAACATGCAGAGGAACAAACAGGTAGCCATGGGC
AGGAAAAAATTTAATATGGACCCTAAAAAGGGGATCCAGTTCTTAATAGAGAACGACCTCCTGAAGAAC
ACTTGTGAAGACATTGCCCAGTTCTTATATAAAGGCGAAGGGCTCAACAAGACAGCCATCGGCGACTAC
CTAGGGGAGAGAGATGAGTTTAATATCCAGGTTCTTCATGCATTTGTGGAGCTGCATGAGTTCACTGAT
CTTAATCTCGTCCAGGCACTACGGCAGTTCCTGTGGAGCTTCCGGCTACCCGGAGAGGCCCAGAAGATC
GACCGGATGATGGAGGCGTTTGCCCAGCGATATTGTCAGTGCAATAATGGCGTGTTCCAGTCCACGGAT
ACTTGTTACGTCCTCTCCTTTGCCATCATCATGTTGAACACCAGTCTGCACAACCCCAATGTCAAAGAT
AAGCCCACTGTGGAGAGGTTCATTGCCATGAACCGAGGCATCAATGATGGGGGAGACCTGCCGGAGGAG
CTCCTCCGGAATCTCTATGAGAGCATAAAAAATGAACCCTTTAAAATCCCAGAAGACGACGGGAATGAC
CTCACTCACACTTTCTTCAATCCAGACCGAGAAGGCTGGCTATTGAAACTCGGTGGCAGGGTAAAGACT
TGGAAGAGACGCTGGTTCATTCTGACTGACAACTGCCTTTACTACTTTGAGTATACCACGGATAAGGAG
CCCCGTGGAATCATCCCTTTAGAGAATCTGAGTATCCGGGAAGTGGAGGACTCCAAAAAACCAAACTGC
TTTGAGCTTTATATCCCCGACAATAAAGACCAAGTTATCAAGGCCTGCAAGACCGAGGCTGACGGGCGG
GTGGTGGAGGGGAACCACACTGTTTACCGGATCTCAGCTCCGACGCCCGAGGAGAAGGAGGAGTGGATT
AAGTGCATTAAAGCAGCCATCAGCAGGGACCCTTTCTACGAAATGCTCGCAGCACGGAAAAAGAAGGTC
TCCTCCACGAAGCGACACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_017456
Insert Size 1194 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_017456.3
RefSeq Size 3363 bp
RefSeq ORF 1194 bp
Locus ID 9267
UniProt ID Q15438
Domains Sec7, PH
MW 46.4 kDa
Gene Summary The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This gene is highly expressed in natural killer and peripheral T cells, and regulates the adhesiveness of integrins at the plasma membrane of lymphocytes. A pseudogene of this gene has been defined on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Transcript Variant: This variant (2) lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...