Signal Peptide Peptidase (HM13) (NM_178580) Human Untagged Clone

CAT#: SC313282

HM13 (untagged)-Human histocompatibility (minor) 13 (HM13), transcript variant 2



  "NM_178580" in other vectors (4)

CNY 6370.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms H13; IMP1; IMPAS; IMPAS-1; MSTP086; PSENL3; PSL3; SPP; SPPL1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC313282 representing NM_178580.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACTCGGCCCTCAGCGATCCGCATAACGGCAGTGCCGAGGCAGGCGGCCCCACCAACAGCACTACG
CGGCCGCCTTCCACGCCCGAGGGCATCGCGCTGGCCTACGGCAGCCTCCTGCTCATGGCGCTGCTGCCC
ATCTTCTTCGGCGCCCTGCGCTCCGTACGCTGCGCCCGCGGCAAGAATGCTTCAGACATGCCTGAAACA
ATCACCAGCCGGGATGCCGCCCGCTTCCCCATCATCGCCAGCTGCACACTCTTGGGGCTCTACCTCTTT
TTCAAAATATTCTCCCAGGAGTACATCAACCTCCTGCTGTCCATGTATTTCTTCGTGCTGGGAATCCTG
GCCCTGTCCCACACCATCAGCCCCTTCATGAATAAGTTTTTTCCAGCCAGCTTTCCAAATCGACAGTAC
CAGCTGCTCTTCACACAGGGTTCTGGGGAAAACAAGGAAGAGATCATCAATTATGAATTTGACACCAAG
GACCTGGTGTGCCTGGGCCTGAGCAGCATCGTTGGCGTCTGGTACCTGCTGAGGAAGCACTGGATTGCC
AACAACCTTTTTGGCCTGGCCTTCTCCCTTAATGGAGTAGAGCTCCTGCACCTCAACAATGTCAGCACT
GGCTGCATCCTGCTGGGCGGACTCTTCATCTACGATGTCTTCTGGGTATTTGGCACCAATGTGATGGTG
ACAGTGGCCAAGTCCTTCGAGGCACCAATAAAATTGGTGTTTCCCCAGGATCTGCTGGAGAAAGGCCTC
GAAGCAAACAACTTTGCCATGCTGGGACTTGGAGATGTCGTCATTCCAGGGATCTTCATTGCCTTGCTG
CTGCGCTTTGACATCAGCTTGAAGAAGAATACCCACACCTACTTCTACACCAGCTTTGCAGCCTACATC
TTCGGCCTGGGCCTTACCATCTTCATCATGCACATCTTCAAGCATGCTCAGCCTGCCCTCCTATACCTG
GTCCCCGCCTGCATCGGTTTTCCTGTCCTGGTGGCGCTGGCCAAGGGAGAAGTGACAGAGATGTTCAGC
TACGAGTCCTCGGCGGAAATCCTGCCTCATACCCCGAGGCTCACCCACTTCCCCACAGTCTCGGGCTCC
CCAGCCAGCCTGGCCGACTCCATGCAGCAGAAGCTAGCTGGCCCTCGCCGCCGGCGCCCGCAGAATCCC
AGCGCCATGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_178580
Insert Size 1185 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_178580.2
RefSeq Size 1827 bp
RefSeq ORF 1185 bp
Locus ID 81502
UniProt ID Q8TCT9
Protein Families Protease, Transmembrane
MW 43.4 kDa
Gene Summary The protein encoded by this gene, which localizes to the endoplasmic reticulum, catalyzes intramembrane proteolysis of some signal peptides after they have been cleaved from a preprotein. This activity is required to generate signal sequence-derived human lymphocyte antigen-E epitopes that are recognized by the immune system, and to process hepatitis C virus core protein. The encoded protein is an integral membrane protein with sequence motifs characteristic of the presenilin-type aspartic proteases. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) contains an alternate exon compared to variant 1, that causes a frameshift. The resulting isoform (2) is longer and has a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...