COX15 (NM_004376) Human Untagged Clone

CAT#: SC313253

COX15 (untagged)-Human COX15 homolog, cytochrome c oxidase assembly protein (yeast) (COX15), nuclear gene encoding mitochondrial protein, transcript variant 2



  "NM_004376" in other vectors (4)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
COX15 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CEMCOX2; MC4DN6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC313253 representing NM_004376.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGCGATTGCTCTTTCCGCCGTTGAGGGCCTTGAAGGGGAGGCAGTATCTGCCGCTCCTGGCTCCT
AGGGCAGCGCCTAGAGCACAGTGTGATTGCATCAGGCGCCCTTTGAGGCCAGGGCAATACAGCACCATC
TCTGAAGTAGCTTTGCAATCTGGAAGGGGTACAGTGTCCCTTCCCTCAAAGGCTGCTGAGCGGGTGGTG
GGCCGATGGCTCCTGGTCTGCAGTGGAACAGTGGCTGGAGCAGTTATTCTTGGTGGAGTAACTAGGTTG
ACAGAGTCTGGCCTCTCGATGGTAGATTGGCATTTAATAAAGGAGATGAAGCCACCTACAAGCCAAGAG
GAATGGGAAGCAGAATTCCAAAGATACCAGCAATTTCCAGAATTTAAAATCTTGAATCATGATATGACA
CTGACAGAATTCAAGTTCATCTGGTACATGGAGTACTCACACCGAATGTGGGGTCGCCTTGTAGGCCTT
GTGTACATCCTGCCTGCTGCCTACTTTTGGAGAAAGGGCTGGCTCAGCCGTGGCATGAAAGGACGTGTT
CTTGCCCTCTGTGGCCTCGTCTGCTTCCAGGGTCTGTTGGGATGGTATATGGTGAAAAGTGGACTAGAA
GAAAAATCAGACTCCCATGACATCCCTCGGGTCAGTCAGTACCGCCTTGCTGCCCACCTGGGATCAGCC
CTGGTTCTTTATTGTGCCAGCTTGTGGACCTCACTGTCACTGCTACTCCCTCCGCACAAGTTGCCTGAA
ACCCACCAACTCCTACAGTTGAGACGATTTGCTCATGGAACAGCAGGTCTGGTGTTCCTTACGGCCCTC
TCAGGGGCTTTTGTGGCAGGGCTAGATGCTGGGCTTGTTTATAACTCCTTTCCCAAAATGGGAGAATCC
TGGATCCCGGAGGACCTCTTTACCTTCTCCCCCATCCTGAGGAATGTTTTTGAGAATCCCACCATGGTG
CAGTTTGATCACCGGATTCTGGGAATCACTTCAGTCACTGCCATTACAGTGCTCTACTTCCTCTCTCGG
AGAATTCCCCTTCCTAGAAGGACCAAGATGGCAGCAGTGACTCTGCTGGCTTTGGCGTATACACAGGGC
CCTGTCTTATTCAACTTTACTTTTAAAATCAGTGATTTGGATGAAGGCATCAGAAACATCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_004376
Insert Size 1167 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_004376.6
RefSeq Size 4337 bp
RefSeq ORF 1167 bp
Locus ID 1355
UniProt ID Q7KZN9
Domains COX15-CtaA
Protein Families Transmembrane
Protein Pathways Metabolic pathways, Oxidative phosphorylation, Porphyrin and chlorophyll metabolism
MW 43.8 kDa
Gene Summary Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be essential for the biogenesis of COX formation and may function in the hydroxylation of heme O, according to the yeast mutant studies. This protein is predicted to contain 5 transmembrane domains localized in the mitochondrial inner membrane. Alternative splicing of this gene generates two transcript variants diverging in the 3' region. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an internal segment in the 3' region, as compared to variant 1. The encoded isoform 2 has a shorter and distinct C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...