ELAVL4 (NM_021952) Human Untagged Clone
CAT＃: SC313227
ELAVL4 (untagged)-Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), transcript variant 1
CNY 3656.00
CNY 6180.00
Product images
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HUD; PNEM |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_021952 edited
ATGGTTATGATAATTAGCACCATGGAGCCTCAGGTGTCAAATGGTCCGACATCCAATACA AGCAATGGACCCTCCAGCAACAACAGAAACTGTCCTTCTCCCATGCAAACAGGGGCAACC ACAGATGACAGCAAAACCAACCTCATCGTCAACTATTTACCCCAGAATATGACCCAAGAA GAATTCAGGAGTCTCTTCGGGAGCATTGGTGAAATAGAATCCTGCAAACTTGTGAGAGAC AAAATTACAGGACAGAGTTTAGGGTATGGATTTGTTAACTATATTGATCCAAAGGATGCA GAGAAAGCCATCAACACTTTAAATGGACTCAGACTCCAGACCAAAACCATAAAGGTCTCA TATGCCCGTCCGAGCTCTGCCTCAATCAGGGATGCTAACCTCTATGTTAGCGGCCTTCCC AAAACCATGACCCAGAAGGAACTGGAGCAACTTTTCTCGCAATACGGCCGTATCATCACC TCACGAATCCTGGTTGATCAAGTCACAGGAGTGTCCAGAGGGGTGGGATTCATCCGCTTT GATAAGAGGATTGAGGCAGAAGAAGCCATCAAAGGGCTGAATGGCCAGAAGCCCAGCGGT GCTACGGAACCGATTACTGTGAAGTTTGCCAACAACCCCAGCCAGAAGTCCAGCCAGGCC CTGCTCTCCCAGCTCTACCAGTCCCCTAACCGGCGCTACCCAGGTCCACTTCACCACCAG GCTCAGAGGTTCAGGCTGGACAATTTGCTTAATATGGCCTATGGCGTAAAGAGACTGATG TCTGGACCAGTCCCCCCTTCTGCTTGTTCCCCCAGGTTCTCCCCAATTACCATTGATGGA ATGACAAGCCTTGTGGGAATGAACATCCCTGGTCACACAGGAACTGGGTGGTGCATCTTT GTCTACAACCTGTCTCCCGATTCCGATGAGAGTGTCCTCTGGCAGCTCTTTGGCCCCTTT GGAGCAGTGAACAACGTAAAGGTGATTCGTGACTTCAACACCAACAAGTGCAAGGGATTC GGCTTTGTCACCATGACCAACTATGATGAGGCGGCCATGGCCATCGCCAGCCTCAACGGG TACCGCCTGGGAGACAGAGTGTTGCAAGTTTCCTTTAAAACCAACAAAGCCCACAAGTCC TGA |
| Restriction Sites | Please inquire |
| ACCN | NM_021952 |
| Insert Size | 1800 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This clone has been fully sequenced and found one SNP within the protein associated with this reference, NM_021952.2. The SNP doesn't change amino acid. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_021952.2, NP_068771.1 |
| RefSeq Size | 1591 bp |
| RefSeq ORF | 1143 bp |
| Locus ID | 1996 |
| UniProt ID | P26378 |
| Domains | RRM |
| Protein Families | Druggable Genome |
| Gene Summary | May play a role in neuron-specific RNA processing. Protects CDKN1A mRNA from decay by binding to its 3' UTR (By similarity). Binds to AU-rich sequences (AREs) of target mRNAs, including VEGF and FOS mRNA.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218612 | ELAVL4 (Myc-DDK-tagged)-Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), transcript variant 1 |
CNY 3656.00 |
|
| RC218612L1 | Lenti ORF clone of Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), transcript variant 1, Myc-DDK-tagged |
CNY 6056.00 |
|
| RC218612L2 | Lenti ORF clone of Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC218612L3 | Lenti ORF clone of Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC218612L4 | Lenti ORF clone of Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), transcript variant 1, mGFP tagged |
CNY 6056.00 |
|
| RG218612 | ELAVL4 (tGFP-tagged) - Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), transcript variant 1 |
CNY 5256.00 |
