DAZAP1 (NM_170711) Human Untagged Clone

CAT#: SC313219

DAZAP1 (untagged)-Human DAZ associated protein 1 (DAZAP1), transcript variant 1



  "NM_170711" in other vectors (4)

CNY 6180.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-DAZAP1 Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC313219 representing NM_170711.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACAACTCGGGCGCCGACGAGATCGGGAAGCTCTTCGTGGGCGGTCTTGACTGGAGCACGACCCAA
GAGACTCTGCGCAGCTACTTTTCCCAATATGGAGAAGTCGTAGATTGTGTTATCATGAAAGATAAAACC
ACCAACCAGTCTCGAGGCTTTGGGTTTGTCAAATTTAAAGACCCAAACTGTGTGGGGACGGTGCTGGCC
AGCAGACCGCACACGCTAGATGGCCGAAACATCGACCCCAAGCCATGCACACCCCGGGGGATGCAGCCG
GAGAGAACACGGCCGAAGGAAGGATGGCAGAAAGGACCCAGGAGCGATAACAGTAAATCAAATAAGATA
TTTGTCGGTGGAATTCCTCACAATTGTGGTGAGACAGAGCTCAGGGAATACTTCAAGAAGTTCGGAGTG
GTCACGGAGGTAGTCATGATCTATGACGCCGAGAAGCAGAGGCCCCGAGGTTTTGGATTTATTACTTTC
GAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTGGAA
GTTAAACGAGCTGAGCCTCGGGACAGCAAGAGCCAAGCGCCGGGACAGCCAGGTGCCAGCCAGTGGGGG
AGCCGGGTTGTGCCCAACGCTGCCAATGGCTGGGCAGGCCAGCCCCCGCCCACGTGGCAGCAAGGATAT
GGCCCGCAAGGAATGTGGGTGCCGGCAGGACAGGCGATTGGTGGCTATGGACCGCCCCCTGCAGGAAGA
GGAGCCCCCCCGCCACCCCCACCGTTCACCTCCTACATCGTGTCCACCCCTCCTGGAGGCTTTCCCCCT
CCCCAGGGCTTCCCTCAGGGCTACGGTGCCCCGCCACAGTTCAGTTTTGGCTACGGGCCTCCACCTCCA
CCGCCAGATCAGTTTGCCCCTCCGGGGGTTCCTCCTCCACCAGCCACTCCCGGGGCAGCACCTCTGGCT
TTCCCACCGCCTCCGTCTCAGGCTGCCCCGGACATGAGCAAGCCCCCGACAGCTCAGCCAGACTTCCCC
TATGGTCAGTATGGCCTGGGTTCCTATTCTCCAGCCCCGCCGGGCTGCGGCCCACACTTTGTTTACAGT
CTTATGGTCAGGCTGAGCAGTGATGTGGCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_170711
Insert Size 1137 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_170711.2
RefSeq Size 2304 bp
RefSeq ORF 1137 bp
Locus ID 26528
UniProt ID Q96EP5
Protein Families Stem cell - Pluripotency
MW 40.5 kDa
Gene Summary In mammals, the Y chromosome directs the development of the testes and plays an important role in spermatogenesis. A high percentage of infertile men have deletions that map to regions of the Y chromosome. The DAZ (deleted in azoospermia) gene cluster maps to the AZFc region of the Y chromosome and is deleted in many azoospermic and severely oligospermic men. It is thought that the DAZ gene cluster arose from the transposition, amplification, and pruning of the ancestral autosomal gene DAZL also involved in germ cell development and gametogenesis. This gene encodes a RNA-binding protein with two RNP motifs that was originally identified by its interaction with the infertility factors DAZ and DAZL. Two isoforms are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the shorter isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...