RCCD1 (NM_033544) Human Untagged Clone
CAT＃: SC313206
RCCD1 (untagged)-Human RCC1 domain containing 1 (RCCD1), transcript variant 1
CNY 7220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_033544, the custom clone sequence may differ by one or more nucleotides
ATGGCGGAGGAGCGGCCGGGGGCCTGGTTCGGCTTCGGTTTCTGCGGCTTCGGGCAGGAG CTGGGCTCCGGACGCGGGCGCCAGGTGCACAGCCCCAGTCCGCTGCGGGCGGGCGTCGAC ATCTGCCGCGTGAGCGCGAGCTGGAGCTACACCGCTTTCGTGACCCGTGGAGGCCGCTTG GAGCTGTCGGGCTCAGCCAGCGGCGCGGCGGGCCGCTGCAAGGACGCGTGGGCCTCGGAG GGGCTCCTCGCGGTGCTGCGCGCCGGGCCGGGGCCGGAGGCGTTACTGCAGGTCTGGGCG GCCGAATCGGCGCTGCGTGGGGAGCCATTGTGGGCCCAGAATGTGGTGCCCGAGGCCGAA GGGGAAGACGATCCGGCCGGTGAGGCCCAGGCTGGGAGGCTACCCCTGCTGCCCTGCGCC CGTGCCTACGTGAGCCCGCGGGCGCCCTTCTACCGGCCTCTGGCTCCGGAGCTGCGGGCA CGCCAGCTGGAGCTGGGCGCCGAGCACGCGTTGCTGCTGGACGCTGCTGGCCAGGTGTTC TCCTGGGGCGGGGGCAGGCATGGACAGCTGGGCCATGGGACCCTGGAGGCAGAGCTGGAG CCACGGCTGTTGGAGGCGTTGCAGGGCCTAGTCATGGCTGAGGTGGCCGCGGGGGGCTGG CATTCTGTGTGTGTGAGTGAGACTGGGGATATTTATATCTGGGGCTGGAATGAATCAGGG CAGCTGGCCCTGCCCACCAGGAACCTGGCAGAGGATGGAGAGACTGTCGCAAGGGAAGCC ACAGAACTGAATGAAGATGGTTCTCAGGTGAAGAGAACGGGTGGGGCTGAGGATGGAGCC CCTGCCCCCTTCATAGCTGTCCAGCCCTTCCCGGCATTACTGGATCTCCCCATGGGCTCA GATGCAGTCAAGGCCAGCTGTGGATCCCGGCACACAGCTGTGGTGACACGAACAGGGGAG CTCTACACCTGGGGCTGGGGTAAATATGGACAGCTGGGCCACGAGGACACCACCAGCTTG GATCGGCCTCGCCGTGTGGAATACTTTGTAGATAAGCAACTCCAAGTAAAGGCTGTCACC TGTGGGCCGTGGAACACCTACGTGTATGCTGTGGAGAAAGGGAAGAGC |
| Restriction Sites | Please inquire |
| ACCN | NM_033544 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_033544.2, NP_291022.2 |
| RefSeq Size | 2774 bp |
| RefSeq ORF | 1131 bp |
| Locus ID | 91433 |
| UniProt ID | A6NED2 |
| Gene Summary | Plays a role in transcriptional repression of satellite repeats, possibly by regulating H3K36 methylation levels in centromeric regions together with KDM8 (PubMed:24981860). Possibly together with KDM8, is involved in proper mitotic spindle organization and chromosome segregation (PubMed:24981860). Plays a role in regulating alpha-tubulin deacetylation and cytoskeletal microtubule stability, thereby promoting cell migration and TGF-beta-induced epithelial to mesenchymal transition (EMT), potentially through the inhibition of KDM8 (PubMed:28455245).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223939 | RCCD1 (Myc-DDK-tagged)-Human RCC1 domain containing 1 (RCCD1), transcript variant 1 |
CNY 3656.00 |
|
| RC223939L3 | Lenti-ORF clone of RCCD1 (Myc-DDK-tagged)-Human RCC1 domain containing 1 (RCCD1), transcript variant 1 |
CNY 5890.00 |
|
| RC223939L4 | Lenti-ORF clone of RCCD1 (mGFP-tagged)-Human RCC1 domain containing 1 (RCCD1), transcript variant 1 |
CNY 5890.00 |
|
| RG223939 | RCCD1 (tGFP-tagged) - Human RCC1 domain containing 1 (RCCD1), transcript variant 1 |
CNY 4370.00 |
