CD46 (NM_172352) Human Untagged Clone
CAT#: SC313135
CD46 (untagged)-Human CD46 molecule, complement regulatory protein (CD46), transcript variant e
CNY 5800.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AHUS2; MCP; MIC10; TLX; TRA2.10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC313135 representing NM_172352.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGCCTCCCGGCCGCCGCGAGTGTCCCTTTCCTTCCTGGCGCTTTCCTGGGTTGCTTCTGGCGGCC ATGGTGTTGCTGCTGTACTCCTTCTCCGATGCCTGTGAGGAGCCACCAACATTTGAAGCTATGGAGCTC ATTGGTAAACCAAAACCCTACTATGAGATTGGTGAACGAGTAGATTATAAGTGTAAAAAAGGATACTTC TATATACCTCCTCTTGCCACCCATACTATTTGTGATCGGAATCATACATGGCTACCTGTCTCAGATGAC GCCTGTTATAGAGAAACATGTCCATATATACGGGATCCTTTAAATGGCCAAGCAGTCCCTGCAAATGGG ACTTACGAGTTTGGTTATCAGATGCACTTTATTTGTAATGAGGGTTATTACTTAATTGGTGAAGAAATT CTATATTGTGAACTTAAAGGATCAGTAGCAATTTGGAGCGGTAAGCCCCCAATATGTGAAAAGGTTTTG TGTACACCACCTCCAAAAATAAAAAATGGAAAACACACCTTTAGTGAAGTAGAAGTATTTGAGTATCTT GATGCAGTAACTTATAGTTGTGATCCTGCACCTGGACCAGATCCATTTTCACTTATTGGAGAGAGCACG ATTTATTGTGGTGACAATTCAGTGTGGAGTCGTGCTGCTCCAGAGTGTAAAGTGGTCAAATGTCGATTT CCAGTAGTCGAAAATGGAAAACAGATATCAGGATTTGGAAAAAAATTTTACTACAAAGCAACAGTTATG TTTGAATGCGATAAGGGTTTTTACCTCGATGGCAGCGACACAATTGTCTGTGACAGTAACAGTACTTGG GATCCCCCAGTTCCAAAGTGTCTTAAAGGTCCTAGGCCTACTTACAAGCCTCCAGTCTCAAATTATCCA GGATATCCTAAACCTGAGGAAGGAATACTTGACAGTTTGGATGTTTGGGTCATTGCTGTGATTGTTATT GCCATAGTTGTTGGAGTTGCAGTAATTTGTGTTGTCCCGTACAGATATCTTCAAAGGAGGAAGAAGAAA GGCACATACCTAACTGATGAGACCCACAGAGAAGTAAAATTTACTTCTCTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_172352 |
Insert Size | 1089 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_172352.2 |
RefSeq Size | 3312 bp |
RefSeq ORF | 1089 bp |
Locus ID | 4179 |
UniProt ID | P15529 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Complement and coagulation cascades |
MW | 40.9 kDa |
Gene Summary | The protein encoded by this gene is a type I membrane protein and is a regulatory part of the complement system. The encoded protein has cofactor activity for inactivation of complement components C3b and C4b by serum factor I, which protects the host cell from damage by complement. In addition, the encoded protein can act as a receptor for the Edmonston strain of measles virus, human herpesvirus-6, and type IV pili of pathogenic Neisseria. Finally, the protein encoded by this gene may be involved in the fusion of the spermatozoa with the oocyte during fertilization. Mutations at this locus have been associated with susceptibility to hemolytic uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2010] Transcript Variant: This variant (e) lacks an alternate in-frame segment compared to variant a, resulting in a shorter isoform (5) compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222330 | CD46 (Myc-DDK-tagged)-Human CD46 molecule, complement regulatory protein (CD46), transcript variant e |
CNY 5488.00 |
|
RC222330L1 | Lenti ORF clone of Human CD46 molecule, complement regulatory protein (CD46), transcript variant e, Myc-DDK-tagged |
CNY 5890.00 |
|
RC222330L2 | Lenti ORF clone of Human CD46 molecule, complement regulatory protein (CD46), transcript variant e, mGFP tagged |
CNY 7888.00 |
|
RC222330L3 | Lenti ORF clone of Human CD46 molecule, complement regulatory protein (CD46), transcript variant e, Myc-DDK-tagged |
CNY 5890.00 |
|
RC222330L4 | Lenti ORF clone of Human CD46 molecule, complement regulatory protein (CD46), transcript variant e, mGFP tagged |
CNY 5890.00 |
|
RG222330 | CD46 (tGFP-tagged) - Human CD46 molecule, complement regulatory protein (CD46), transcript variant e |
CNY 7088.00 |