Carboxypeptidase B2 (CPB2) (NM_016413) Human Untagged Clone
CAT#: SC313122
CPB2 (untagged)-Human carboxypeptidase B2 (plasma) (CPB2), transcript variant 2
CNY 3656.00
CNY 5800.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CPU; PCPB; TAFI |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_016413 edited
ATTGCTGTTGGGATGAAGCTTTGCAGCCTTGCAGTCCTTGTACCCATTGTTCTCTTCTGT GAGCAGCATGTCTTCGCGTTTCAGAGTGGCCAAGTTCTAGCTGCTCTTCCTAGAACCTCT AGGCAAGTTCAAGTTCTACAGAATCTTACTACAACATATGAGATTGTTCTCTGGCAGCCG GTAACAGCTGACCTTATTGTGAAGAAAAAACAAGTCCATTTTTTTGTAAATGCATCTGAT GTCGACAATGTGAAAGCCCATTTAAATGTGAGCGGAATTCCATGCAGTGTCTTGCTGGCA GATGTGGAAGATCTTATTCAACAGCAGATTTCCAACGACACAGTCAGCCCCCGAGCCTCC GCATCGTACTATGAACAGTATCACTCACTAAATGAAATCTATTCTTGGATAGAATTTATA ACTGAGAGGCATCCTGATATGCTTACAAAAATCCACATTGGATCCTCATTTGAGAAGTAC CCACTCTATGTTTTAAAGGTTTCTGGAAAAGAACAAGCAGCCAAAAATGCCATATGGATT GACTGTGGAATCCATGCCAGAGAATGGATCTCTCCTGCTTTCTGCTTGTGGTTCATAGGC CATAATCGAATGTGGAGAAAGAACCGTTCTTTCTATGCGAACAATCATTGCATCGGAACA GACCTGAATAGGAACTTTGCTTCCAAACACTGGTGTGAGGAAGGTGCATCCAGTTCCTCA TGCTCGGAAACCTACTGTGGACTTTATCCTGAGTCAGAACCAGAAGTGAAGGCAGTGGCT AGTTTCTTGAGAAGAAATATCAACCAGATTAAAGCATACATCAGCATGCATTCATACTCC CAGCATATAGTGTTTCCATATTCCTATACACGAAGTAAAAGCAAAGACCATGAGGAACTG TCTCTAGTAGCCAGTGAAGCAGTTCGTGCTATTGAGAAAACTAGTAAAAATACCAGGTAT ACACATGGCCATGGCTCAGAAACCTTATACCTAGCTCCTGGAGGTGGGGACGATTGGATC TATGATTTGGGCATCAAATATTCCGTTACATCAAACCCACCTGTAGAGAAGCTTTTGCCG CTGTCTCTAAAATAG |
Restriction Sites | Please inquire |
ACCN | NM_016413 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_016413.2, NP_057497.2 |
RefSeq Size | 1560 bp |
RefSeq ORF | 1083 bp |
Locus ID | 1361 |
Domains | Zn_carbOpept, Propep_M14 |
Protein Families | Druggable Genome, Protease, Secreted Protein |
Protein Pathways | Complement and coagulation cascades |
Gene Summary | Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). The protein encoded by this gene is activated by trypsin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. Polymorphisms have been described for this gene and its promoter region. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (2) lacks two segments in the coding region when compared to variant 1. The absence of the second segment causes a frameshift; therefore, isoform b lacks an internal aa fragment and has a distinct C-terminus when compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218711 | CPB2 (Myc-DDK-tagged)-Human carboxypeptidase B2 (plasma) (CPB2), transcript variant 2 |
CNY 3656.00 |
|
RC218711L3 | Lenti ORF clone of Human carboxypeptidase B2 (plasma) (CPB2), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC218711L4 | Lenti ORF clone of Human carboxypeptidase B2 (plasma) (CPB2), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG218711 | CPB2 (tGFP-tagged) - Human carboxypeptidase B2 (plasma) (CPB2), transcript variant 2 |
CNY 4370.00 |
其它Carboxypeptidase B2产品