CAMK1D (NM_020397) Human Untagged Clone
CAT#: SC313112
CAMK1D (untagged)-Human calcium/calmodulin-dependent protein kinase ID (CAMK1D), transcript variant 1
CNY 3656.00
CNY 5800.00
Product images
CNY 6281.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CaM-K1; CaMKID; CKLiK |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_020397 edited
ATGGCCCGGGAGAACGGCGAGAGCAGCTCCTCCTGGAAAAAGCAAGCTGAAGACATCAAG AAGATCTTCGAGTTCAAAGAGACCCTCGGAACCGGGGCCTTTTCCGAAGTGGTTTTAGCT GAAGAGAAGGCAACTGGCAAGCTCTTTGCTGTGAAGTGTATCCCTAAGAAGGCGCTGAAG GGCAAGGAAAGCAGCATAGAGAATGAGATAGCCGTCCTGAGAAAGATTAAGCATGAAAAT ATTGTTGCCCTGGAAGACATTTATGAAAGCCCAAATCACCTGTACTTGGTCATGCAGCTG GTGTCCGGTGGAGAGCTGTTTGACCGGATAGTGGAGAAGGGGTTTTATACAGAGAAGGAT GCCAGCACTCTGATCCGCCAAGTCTTGGACGCCGTGTACTATCTCCACAGAATGGGCATC GTCCACAGAGACCTCAAGCCCGAAAATCTCTTGTACTACAGTCAAGATGAGGAGTCCAAA ATAATGATCAGTGACTTTGGATTGTCAAAAATGGAGGGCAAAGGAGATGTGATGTCCACT GCCTGTGGAACTCCAGGCTATGTCGCTCCTGAAGTCCTCGCCCAGAAACCTTACAGCAAA GCCGTTGACTGCTGGTCCATCGGAGTGATTGCCTACATCTTGCTCTGCGGCTACCCTCCT TTTTATGATGAAAATGACTCCAAGCTCTTTGAGCAGATCCTCAAGGCGGAATATGAGTTT GACTCTCCCTACTGGGATGACATCTCCGACTCTGCAAAAGACTTCATTCGGAACCTGATG GAGAAGGACCCGAATAAAAGATACACGTGTGAGCAGGCAGCTCGGCACCCATGGATCGCT GGTGACACAGCCCTCAACAAAAACATCCACGAGTCCGTCAGCGCCCAGATCCGGAAAAAC TTTGCCAAGAGCAAATGGAGACAAGCATTTAATGCCACGGCCGTCGTCAGACATATGAGA AAACTACACCTCGGCAGCAGCCTGGACAGTTCAAATGCAAGTGTTTCGAGCAGCCTCAGT TTGGCCAGCCAAAAAGACTGTGCGTATGTAGCAAAACCAGAATCCCTCAGCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_020397 |
| Insert Size | 1300 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_020397.2, NP_065130.1 |
| RefSeq Size | 1727 bp |
| RefSeq ORF | 1074 bp |
| Locus ID | 57118 |
| UniProt ID | Q8IU85 |
| Protein Families | Druggable Genome, Protein Kinase |
| Gene Summary | This gene is a member of the calcium/calmodulin-dependent protein kinase 1 family, a subfamily of the serine/threonine kinases. The encoded protein is a component of the calcium-regulated calmodulin-dependent protein kinase cascade. It has been associated with multiple processes including regulation of granulocyte function, activation of CREB-dependent gene transcription, aldosterone synthesis, differentiation and activation of neutrophil cells, and apoptosis of erythroleukemia cells. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jan 2015] Transcript Variant: This variant (1) lacks the 3' terminal exon used in variant 2, and its 3' terminal exon extends past a splice site that is used in variant 2. It encodes isoform 1, which has a shorter and distinct C-terminus, compared to isoform 2. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217129 | CAMK1D (Myc-DDK-tagged)-Human calcium/calmodulin-dependent protein kinase ID (CAMK1D), transcript variant 1 |
CNY 3656.00 |
|
| RC217129L3 | Lenti ORF clone of Human calcium/calmodulin-dependent protein kinase ID (CAMK1D), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC217129L4 | Lenti ORF clone of Human calcium/calmodulin-dependent protein kinase ID (CAMK1D), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG217129 | CAMK1D (tGFP-tagged) - Human calcium/calmodulin-dependent protein kinase ID (CAMK1D), transcript variant 1 |
CNY 4370.00 |
