Pregnancy specific beta 1 glycoprotein 11 (PSG11) (NM_002785) Human Untagged Clone

CAT#: SC313025

PSG11 (untagged)-Human pregnancy specific beta-1-glycoprotein 11 (PSG11), transcript variant 1



  "NM_002785" in other vectors (6)

CNY 3656.00

CNY 5420.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PSBG-11; PSBG-13; PSG13; PSG14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC313025 representing NM_002785.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGCCCCTCTCAGCCCCTCCCTGCACAGAGCACATCAAATGGAAGGGGCTCCTGCTCACAGCATTA
CTTTTAAACTTCTGGAACTTGCCTACCACTGCCCAAGTCATGATTGAAGCCCAGCCACCCAAAGTGTCC
GAGGGGAAGGATGTTCTTCTACTTGTCCACAATTTGCCCCAGAATCTTACTGGCTACATCTGGTACAAA
GGGCAAATCAGGGACCTCTACCATTACATTACATCATATGTAGTAGACGGTCAAATAATTATATATGGA
CCGGCATACAGTGGACGAGAAACAGTATATTCCAATGCATCCCTGCTGATCCAGAATGTCACCCGGGAG
GACGCAGGATCCTACACCTTACACATCATAAAGCGAGGTGATGGGACTAGAGGAGTAACTGGATATTTC
ACCTTCACCTTATACCTGGAGACTCCCAAGCCCTCCATCTCCAGCAGCAACTTAAACCCCAGGGAGGCC
ATGGAGACTGTGATCTTAACCTGTAATCCTGAGACTCCGGACGCAAGCTACCTGTGGTGGATGAATGGT
CAGAGCCTCCCTATGACTCATAGGATGCAGCTGTCTGAAACCAACAGGACCCTCTTTCTATTTGGTGTC
ACAAAGTATACTGCAGGACCCTATGAATGTGAAATATGGAACTCAGGGAGTGCCAGCCGCAGTGACCCA
GTCACCCTGAATCTCCTCCATGGTCCAGACCTCCCCAGAATTTTCCCTTCAGTCACCTCTTACTATTCA
GGAGAGAACCTCGACTTGTCCTGCTTCGCAAACTCTAACCCACCAGCACAGTATTCTTGGACAATTAAT
GGGAAGTTTCAGCTATCAGGACAAAAGCTCTTTATCCCTCAGATTACTCCAAAGCATAATGGGCTCTAT
GCTTGCTCTGCTCGTAACTCAGCCACTGGCGAGGAAAGCTCCACATCCTTGACAATCAGAGTCATTGCT
CCTCCAGGATTAGGAACTTTTGCTTTCAATAATCCAACGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_002785
Insert Size 1008 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002785.2
RefSeq Size 1541 bp
RefSeq ORF 1008 bp
Locus ID 5680
UniProt ID Q9UQ72
Domains ig, IGc2, IG
Protein Families Secreted Protein
MW 37.1 kDa
Gene Summary The human pregnancy-specific glycoproteins (PSGs) are a group of molecules that are mainly produced by the placental syncytiotrophoblasts during pregnancy. PSGs comprise a subgroup of the carcinoembryonic antigen (CEA) family, which belongs to the immunoglobulin superfamily. For additional general information about the PSG gene family, see PSG1 (MIM 176390).[supplied by OMIM, Oct 2009]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Pregnancy specific beta 1 glycoprotein 11产品

Customer Reviews 
Loading...