RASSF1 (NM_007182) Human Untagged Clone
CAT#: SC313020
RASSF1 (untagged)-Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant A
CNY 5488.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 123F2; NORE2A; RASSF1A; RDA32; REH3P21 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_007182 edited
CAGTCTGGATCCTGGGGGAGGCGCTGAAGTCGGGGCCCGCCCTGTGGCCCCGCCCGGCCC GCGCTTGCTAGCGCCCAAAGCCAGCGAAGCACGGGCCCAACCGGGCCATGTCGGGGGAGC CTGAGCTCATTGAGCTGCGGGAGCTGGCACCCGCTGGGCGCGCTGGGAAGGGCCGCACCC GGCTGGAGCGTGCCAACGCGCTGCGCATCGCGCGGGGCACCGCGTGCAACCCCACACGGC AGCTGGTCCCTGGCCGTGGCCACCGCTTCCAGCCCGCGGGGCCCGCCACGCACACGTGGT GCGACCTCTGTGGCGACTTCATCTGGGGCGTCGTGCGCAAAGGCCTGCAGTGCGCGCATT GCAAGTTCACCTGCCACTACCGCTGCCGCGCGCTCGTCTGCCTGGACTGTTGCGGGCCCC GGGACCTGGGCTGGGAACCCGCGGTGGAGCGGGACACGAACGTGGACGAGCCTGTGGAGT GGGAGACACCTGACCTTTCTCAATCTGAGATTGAGCAGAAGATCAAGGAGTACAATGCCC AGATCAACAGCAACCTCTTCATGAGCTTGAACAAGGACGGTTCTTACACAGGCTTCATCA AGGTTCAGCTGAAGCTGGTGCGCCCTGTCTCTGTGCCCTCCAGCAAGAAGCCACCCTCCT TGCAGGATGCCCGGCGGGGCCCAGGACGGGGCACAAGTGTCAGGCGCCGCACTTCCTTTT ACCTGCCCAAGGATGCTGTCAAGCACCTGCATGTGCTGTCACGCACAAGGGCACGTGAAG TCATTGAGGCCCTGCTGCGAAAGTTCTTGGTGGTGGATGACCCCCGCAAGTTTGCACTCT TTGAGCGCGCTGAGCGTCACGGCCAAGTGTACTTGCGGAAGCTGTTGGATGATGAGCAGC CCCTGCGGCTGCGGCTCCTGGCAGGGCCCAGTGACAAGGCCCTGAGCTTTGTCCTGAAGG AAAATGACTCTGGGGAGGTGAACTGGGACGCCTTCAGCATGCCTGAACTACATAACTTCC TACGTATCCTGCAGCGGGAGGAGGAGGAGCACCTCCGCCAGATCCTGCAGAAGTACTCCT ATTGCCGCCAGAAGATCCAAGAGGCCCTGCACGCCTGCCCCCTTGGGTGACCTCTTGTAC CCCCAGGTGGAAGGCAGACAGCAGGCAGCGCCAAGTGCGTGCCGTGTGAGTGTGACAGGG CCAGTGGGGCCTGTGGAATGAGTGTGCATGGAGGCCCTCCTGTGCTGGGGGAATGAGCCC AGAGAACAGCGAAGTAGCTTGCTCCCTGTGTCCACCTGTGGG |
Restriction Sites | Please inquire |
ACCN | NM_007182 |
Insert Size | 1300 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_007182.4. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_007182.4, NP_009113.3 |
RefSeq Size | 1968 bp |
RefSeq ORF | 1023 bp |
Locus ID | 11186 |
UniProt ID | Q9NS23 |
Domains | RA, DAG_PE-bind |
Protein Families | Druggable Genome |
Protein Pathways | Bladder cancer, Non-small cell lung cancer, Pathways in cancer |
Gene Summary | This gene encodes a protein similar to the RAS effector proteins. Loss or altered expression of this gene has been associated with the pathogenesis of a variety of cancers, which suggests the tumor suppressor function of this gene. The inactivation of this gene was found to be correlated with the hypermethylation of its CpG-island promoter region. The encoded protein was found to interact with DNA repair protein XPA. The protein was also shown to inhibit the accumulation of cyclin D1, and thus induce cell cycle arrest. Several alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, May 2011] Transcript Variant: This variant (A) lacks an in-frame coding segment compared to variant D, resulting an isoform (A) that lacks an internal region, as compared to isoform D. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213525 | RASSF1 (Myc-DDK-tagged)-Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant A |
CNY 5488.00 |
|
RC213525L1 | Lenti ORF clone of Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant A, Myc-DDK-tagged |
CNY 7888.00 |
|
RC213525L2 | Lenti ORF clone of Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant A, mGFP tagged |
CNY 5890.00 |
|
RC213525L3 | Lenti ORF clone of Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant A, Myc-DDK-tagged |
CNY 5890.00 |
|
RC213525L4 | Lenti ORF clone of Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant A, mGFP tagged |
CNY 7888.00 |
|
RG213525 | RASSF1 (tGFP-tagged) - Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant A |
CNY 7088.00 |