PPM1A (NM_177951) Human Untagged Clone
CAT#: SC312956
PPM1A (untagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1A (PPM1A), transcript variant 2
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PP2C-ALPHA; PP2CA; PP2Calpha |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC312956 representing NM_177951.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGAGCATTTTTAGACAAGCCAAAGATGGAAAAGCATAATGCCCAGGGGCAGGGTAATGGGTTGCGA TATGGGCTAAGCAGCATGCAAGGCTGGCGTGTTGAAATGGAGGATGCACATACGGCTGTGATCGGTTTG CCAAGTGGACTTGAATCGTGGTCATTCTTTGCTGTGTATGATGGGCATGCTGGTTCTCAGGTTGCCAAA TACTGCTGTGAGCATTTGTTAGATCACATCACCAATAACCAGGATTTTAAAGGGTCTGCAGGAGCACCT TCTGTGGAAAATGTAAAGAATGGAATCAGAACAGGTTTTCTGGAGATTGATGAACACATGAGAGTTATG TCAGAGAAGAAACATGGTGCAGATAGAAGTGGGTCAACAGCTGTAGGTGTCTTAATTTCTCCCCAACAT ACTTATTTCATTAACTGTGGAGACTCAAGAGGTTTACTTTGTAGGAACAGGAAAGTTCATTTCTTCACA CAAGATCACAAACCAAGTAATCCGCTGGAGAAAGAACGAATTCAGAATGCAGGTGGCTCTGTAATGATT CAGCGTGTGAATGGCTCTCTGGCTGTATCGAGGGCCCTTGGGGATTTTGATTACAAATGTGTCCATGGA AAAGGTCCTACTGAGCAGCTTGTCTCACCAGAGCCTGAAGTCCATGATATTGAAAGATCTGAAGAAGAT GATCAGTTCATTATCCTTGCATGTGATGGTATCTGGGATGTTATGGGAAATGAAGAGCTCTGTGATTTT GTAAGATCCAGACTTGAAGTCACTGATGACCTTGAGAAAGTTTGCAATGAAGTAGTCGACACCTGTTTG TATAAGGGAAGTCGAGACAACATGAGTGTGATTTTGATCTGTTTTCCAAATGCACCCAAAGTATCGCCA GAAGCAGTGAAGAAGGAGGCAGAGTTGGACAAGTACCTGGAATGCAGAGTAGAAGGTGGATCATTTAAC AAAAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_177951 |
Insert Size | 975 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_177951.2 |
RefSeq Size | 4334 bp |
RefSeq ORF | 975 bp |
Locus ID | 5494 |
UniProt ID | P35813 |
Protein Families | Druggable Genome, Phosphatase |
Protein Pathways | MAPK signaling pathway |
MW | 36 kDa |
Gene Summary | The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase dephosphorylates, and negatively regulates the activities of, MAP kinases and MAP kinase kinases. It has been shown to inhibit the activation of p38 and JNK kinase cascades induced by environmental stresses. This phosphatase can also dephosphorylate cyclin-dependent kinases, and thus may be involved in cell cycle control. Overexpression of this phosphatase is reported to activate the expression of the tumor suppressor gene TP53/p53, which leads to G2/M cell cycle arrest and apoptosis. Three alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) has an additional exon within the 5' UTR and lacks a few of 3' exons but has an alternate 3' segment, as compared to variant 1. The resulting isoform (2) has a distinct and shorter C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218055 | PPM1A (Myc-DDK-tagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1A (PPM1A), transcript variant 2 |
CNY 2400.00 |
|
RC218055L3 | Lenti-ORF clone of PPM1A (Myc-DDK-tagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1A (PPM1A), transcript variant 2 |
CNY 5890.00 |
|
RC218055L4 | Lenti-ORF clone of PPM1A (mGFP-tagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1A (PPM1A), transcript variant 2 |
CNY 5890.00 |
|
RG218055 | PPM1A (tGFP-tagged) - Human protein phosphatase, Mg2+/Mn2+ dependent, 1A (PPM1A), transcript variant 2 |
CNY 4370.00 |