B3GAT2 (NM_080742) Human Untagged Clone
CAT#: SC312951
B3GAT2 (untagged)-Human beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) (B3GAT2)
CNY 2400.00
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GLCATS |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_080742 edited
ATGAAGTCCGCGCTTTTCACCCGCTTCTTTATCCTCCTGCCCTGGATCCTAATTGTCATC ATCATGCTCGACGTGGACACGCGCAGGCCAGTGCCCCCGCTCACCCCGCGCCCCTACTTC TCTCCCTACGCGGTGGGCCGCGGGGGCGCCCGACTCCCGCTCCGCAGGGGCGGCCCGGCT CACGGGACCCAAAAGCGCAACCAGTCTCGGCCGCAGCCACAGCCGGAGCCGCAGCTGCCC ACCATCTATGCCATCACGCCCACCTACAGCCGCCCGGTGCAGAAAGCGGAGCTGACCCGC CTGGCCAACACGTTCCGCCAGGTGGCGCAGCTGCACTGGATCCTGGTGGAGGACGCGGCG GCGCGCAGCGAGCTGGTGAGCCGCTTCCTGGCGCGGGCCGGGCTGCCCAGCACTCACCTG CACGTGCCCACGCCGCGGCGCTACAAGCGGCCCGGGCTGCCGCGCGCCACTGAGCAGCGC AACGCGGGCCTCGCCTGGCTGCGCCAGAGGCACCAGCACCAGCGCGCGCAGCCCGGCGTG CTCTTCTTCGCTGACGACGACAACACCTATAGTCTGGAGCTCTTCCAGGAGATGCGAACC ACCCGCAAGGTCTCCGTCTGGCCTGTGGGCCTGGTTGGTGGGCGGCGCTACGAACGTCCG CTGGTGGAAAACGGCAAAGTTGTTGGCTGGTACACCGGCTGGAGAGCAGACAGGCCTTTT GCCATCGACATGGCAGGATTTGCTGTAAGTCTTCAAGTCATTTTGTCCAATCCAAAAGCT GTATTTAAGCGTCGTGGATCCCAGCCAGGGATGCAAGAATCTGACTTTCTCAAACAGATA ACAACAGTCGAAGAACTGGAACCGAAAGCAAATAACTGCACTAAGGTTCTCGTGTGGCAC ACTCGGACAGAGAAGGTTAATCTAGCCAACGAGCCAAAGTACCACCTGGACACAGTGAAA ATTGAGGTATAA |
Restriction Sites | Please inquire |
ACCN | NM_080742 |
Insert Size | 1000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_080742.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_080742.1, NP_542780.1 |
RefSeq Size | 972 bp |
RefSeq ORF | 972 bp |
Locus ID | 135152 |
UniProt ID | Q9NPZ5 |
Domains | Glyco_transf_43 |
Protein Families | Transmembrane |
Protein Pathways | Chondroitin sulfate biosynthesis, Heparan sulfate biosynthesis, Metabolic pathways |
Gene Summary | The product of this gene is a transmembrane protein belonging to the glucuronyltransferase family, and catalyzes the transfer of a beta-1,3 linked glucuronic acid to a terminal galactose in different glycoproteins or glycolipids containing a Gal-beta-1-4GlcNAc or Gal-beta-1-3GlcNAc residue. The encoded protein is involved in the synthesis of the human natural killer-1 (HNK-1) carbohydrate epitope, a sulfated trisaccharide implicated in cellular migration and adhesion in the nervous system. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224329 | B3GAT2 (Myc-DDK-tagged)-Human beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) (B3GAT2) |
CNY 2400.00 |
|
RC224329L3 | Lenti ORF clone of Human beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) (B3GAT2), Myc-DDK-tagged |
CNY 5890.00 |
|
RC224329L4 | Lenti ORF clone of Human beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) (B3GAT2), mGFP tagged |
CNY 5890.00 |
|
RG224329 | B3GAT2 (tGFP-tagged) - Human beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) (B3GAT2) |
CNY 4000.00 |