MEIS2 (NM_172316) Human Untagged Clone

CAT#: SC312879

MEIS2 (untagged)-Human Meis homeobox 2 (MEIS2), transcript variant h



  "NM_172316" in other vectors (4)

CNY 6270.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-MEIS2 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CPCMR; HsT18361; MRG1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_172316, the custom clone sequence may differ by one or more nucleotides
ATGGCTCTGGTCTTTGAGAAGTGCGAGCTGGCGACCTGCACTCCCCGGGAACCTGGAGTG
GCTGGCGGAGACGTCTGCTCCTCCGACTCCTTCAACGAGGACATCGCGGTCTTCGCCAAG
CAGGTTCGCGCCGAAAAGCCACTTTTTTCCTCAAATCCAGAGCTGGACAATTTGATGATA
CAAGCAATACAAGTACTAAGGTTTCATCTTTTGGAGTTAGAAAAGGTCCACGAACTGTGC
GATAACTTCTGCCACCGATACATTAGCTGTTTGAAGGGGAAAATGCCCATCGACCTCGTC
ATTGATGAAAGAGACGGCAGCTCCAAGTCAGATCATGAAGAACTTTCAGGCTCCTCCACA
AATCTCGCTGACCATAACCCTTCTTCTTGGCGAGACCACGATGATGCAACCTCAACCCAC
TCAGCAGGCACCCCAGGGCCCTCCAGTGGGGGCCATGCTTCCCAGAGCGGAGACAACAGC
AGTGAGCAAGGGGATGGTTTAGACAACAGTGTAGCTTCACCTGGTACAGGTGACGATGAT
GATCCGGATAAGGACAAAAAACGCCAGAAGAAAAGAGGCATTTTCCCCAAAGTAGCAACA
AATATCATGAGAGCATGGCTCTTCCAGCATCTCACACATCCGTACCCTTCCGAAGAGCAG
AAGAAACAGTTAGCGCAAGACACAGGACTTACAATTCTCCAAGTAAACAACTGGTTTATT
AATGCCAGAAGAAGAATAGTACAGCCCATGATTGACCAGTCAAATCGAGCAGTGAGCCAA
GGAGCAGCATATAGTCCAGAGGGTCAGCCCATGGGGAGCTTTGTGTTGGATGGTCAGCAA
CACATGGGGATCCGGCCTGCAGGACCTATGAGTGGAATGGGCATGAATATGGGCATGGAT
GGGCAATGGCACTACATG
Restriction Sites Please inquire     
ACCN NM_172316
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_172316.1, NP_758527.1
RefSeq Size 3175 bp
RefSeq ORF 921 bp
Locus ID 4212
UniProt ID O14770
Protein Families Transcription Factors
Gene Summary This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. TALE homeobox proteins are highly conserved transcription regulators, and several members have been shown to be essential contributors to developmental programs. Multiple transcript variants encoding distinct isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (h) differs in the 5' UTR and coding sequence compared to isoform a. The resulting isoform (h) has a shorter and distinct N-terminus and lacks an alternate internal segment compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...