FGFR1 (NM_023108) Human Untagged Clone
CAT#: SC312859
FGFR1 (untagged)-Human fibroblast growth factor receptor 1 (FGFR1), transcript variant 6
CNY 6270.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BFGFR; CD331; CEK; FGFBR; FLG; FLJ99988; FLT2; HBGFR; KAL2; N-SAM; OGD |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC312859 representing NM_023108.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTGGAGCTGGAAGTGCCTCCTCTTCTGGGCTGTGCTGGTCACAGCCACACTCTGCACCGCTAGGCCG TCCCCGACCTTGCCTGAACAAGATGCTCTCCCCTCCTCGGAGGATGATGATGATGATGATGACTCCTCT TCAGAGGAGAAAGAAACAGATAACACCAAACCAAACCCCGTAGCTCCATATTGGACATCCCCAGAAAAG ATGGAAAAGAAATTGCATGCAGTGCCGGCTGCCAAGACAGTGAAGTTCAAATGCCCTTCCAGTGGGACC CCAAACCCCACACTGCGCTGGTTGAAAAATGGCAAAGAATTCAAACCTGACCACAGAATTGGAGGCTAC AAGGTCCGTTATGCCACCTGGAGCATCATAATGGACTCTGTGGTGCCCTCTGACAAGGGCAACTACACC TGCATTGTGGAGAATGAGTACGGCAGCATCAACCACACATACCAGCTGGATGTCGTGGAGCGGTCCCCT CACCGGCCCATCCTGCAAGCAGGGTTGCCCGCCAACAAAACAGTGGCCCTGGGTAGCAACGTGGAGTTC ATGTGTAAGGTGTACAGTGACCCGCAGCCGCACATCCAGTGGCTAAAGCACATCGAGGTGAATGGGAGC AAGATTGGCCCAGACAACCTGCCTTATGTCCAGATCTTGAAGGTAATCATGGCACCAGTCTTCGTGGGC CAGTCTACTGGGAAGGAGACCACTGTCTCGGGGGCTCAAGTTCCTGTGGGCAGGCTCAGTTGCCCCCGA ATGGGATCATTCCTCACGCTTCAGGCACACACACTCCATCTCAGTAGGGATCTAGCCACATCCCCCAGG ACTAGTAACAGAGGTCACAAAGTGGAGGTGAGCTGGGAACAGAGGGCTGCAGGGATGGGTGGTGCTGGT CTGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_023108 |
Insert Size | 903 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_023108.2 |
RefSeq Size | 2801 bp |
RefSeq ORF | 903 bp |
Locus ID | 2260 |
Domains | ig |
Protein Families | Druggable Genome, Protein Kinase, Transmembrane |
Protein Pathways | Adherens junction, MAPK signaling pathway, Melanoma, Pathways in cancer, Prostate cancer, Regulation of actin cytoskeleton |
MW | 33.1 kDa |
Gene Summary | The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. Mutations in this gene have been associated with Pfeiffer syndrome, Jackson-Weiss syndrome, Antley-Bixler syndrome, osteoglophonic dysplasia, and autosomal dominant Kallmann syndrome 2. Chromosomal aberrations involving this gene are associated with stem cell myeloproliferative disorder and stem cell leukemia lymphoma syndrome. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (6) differs in the 3' UTR and lacks multiple exons in the 3' coding region, which results in an early stop codon, compared to variant 1. This variant encodes isoform 6, also known as isoform H5 and the secreted form, which is much shorter, has distinct C-terminus, and lacks the transmembrane domain, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214979 | FGFR1 (Myc-DDK-tagged)-Human fibroblast growth factor receptor 1 (FGFR1), transcript variant 6 |
CNY 2400.00 |
|
RC214979L3 | Lenti ORF clone of Human fibroblast growth factor receptor 1 (FGFR1), transcript variant 6, Myc-DDK-tagged |
CNY 5890.00 |
|
RC214979L4 | Lenti ORF clone of Human fibroblast growth factor receptor 1 (FGFR1), transcript variant 6, mGFP tagged |
CNY 5890.00 |
|
RG214979 | FGFR1 (tGFP-tagged) - Human fibroblast growth factor receptor 1 (FGFR1), transcript variant 6 |
CNY 4370.00 |