NALP12 (NLRP12) (NM_033297) Human Untagged Clone
CAT#: SC312810
NLRP12 (untagged)-Human NLR family, pyrin domain containing 12 (NLRP12), transcript variant 1
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC312810 representing NM_033297.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGCCAGGCATGGTGGCACACGTCTGTAAGCCCAGCTACTCAGGAGGCCAAGGCAGGAGGATTGCTT CAACCCAGGAGGCAGAGGTTGTGGCTGAAGAGGTGCCGCATCTCCAGCTCAGCCTGCGAGGACCTCTCT GCAGCTCTCATAGCCAATAAGAATTTGACAAGGATGGATCTCAGTGGCAACGGCGTTGGATTCCCAGGC ATGATGCTGCTTTGCGAGGGCCTGCGGCATCCCCAATGCAGGCTGCAGATGATTCAGTTGAGGAAGTGT CAGCTGGAGTCCGGGGCTTGTCAGGAGATGGCTTCTGTGCTCGGCACCAACCCACATCTGGTTGAGTTG GACCTGACAGGAAATGCACTGGAGGATTTGGGCCTGAGGTTACTATGCCAGGGACTGAGGCACCCAGTC TGCAGACTACGGACTTTGTGGCTGAAGATCTGCCGCCTCACTGCTGCTGCCTGTGACGAGCTGGCCTCA ACTCTCAGTGTGAACCAGAGCCTGAGAGAGCTGGACCTGAGCCTGAATGAGCTGGGGGACCTCGGGGTG CTGCTGCTGTGTGAGGGCCTCAGGCATCCCACGTGCAAGCTCCAGACCCTGCGGCTGGATAGCTGTGGC CTCACAGCCAAGGCTTGTGAGAATCTTTACTTCACCCTGGGGATCAACCAGACCTTGACCGACCTTTAC CTGACCAACAACGCCCTAGGGGACACAGGTGTCCGACTGCTTTGCAAGCGGCTGAGCCATCCTGGCTGC AAACTCCGAGTCCTCTGGTTATTTGGGATGGACCTGAATAAAATGACCCACAGTAGGTTGGCAGCGCTT CGAGTAACAAAACCTTATTTGGACATTGGCTGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_033297 |
| Insert Size | 864 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_033297.2 |
| RefSeq Size | 2638 bp |
| RefSeq ORF | 864 bp |
| Locus ID | 91662 |
| Domains | LRR, LRR_RI |
| MW | 31.8 kDa |
| Gene Summary | This gene encodes a member of the CATERPILLER family of cytoplasmic proteins. The encoded protein, which contains an N-terminal pyrin domain, a NACHT domain, a NACHT-associated domain, and a C-terminus leucine-rich repeat region, functions as an attenuating factor of inflammation by suppressing inflammatory responses in activated monocytes. Mutations in this gene cause familial cold autoinflammatory syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013] Transcript Variant: This variant (1) differs in the 5' UTR, lacks multiple exons in the 5' coding region, and uses a downstream start codon compared to variant 2. The encoded isoform (1) is shorter and has a distinct N-terminus compared to isoform 2. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214946 | NLRP12 (Myc-DDK-tagged)-Human NLR family, pyrin domain containing 12 (NLRP12), transcript variant 1 |
CNY 2400.00 |
|
| RC214946L1 | Lenti ORF clone of Human NLR family, pyrin domain containing 12 (NLRP12), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
| RC214946L2 | Lenti ORF clone of Human NLR family, pyrin domain containing 12 (NLRP12), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC214946L3 | Lenti ORF clone of Human NLR family, pyrin domain containing 12 (NLRP12), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC214946L4 | Lenti ORF clone of Human NLR family, pyrin domain containing 12 (NLRP12), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG214946 | NLRP12 (tGFP-tagged) - Human NLR family, pyrin domain containing 12 (NLRP12), transcript variant 1 |
CNY 4370.00 |
