TMEPAI (PMEPA1) (NM_020182) Human Untagged Clone
CAT#: SC312809
PMEPA1 (untagged)-Human prostate transmembrane protein, androgen induced 1 (PMEPA1), transcript variant 1
CNY 2400.00
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | STAG1; TMEPAI |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_020182 edited
GGGCGCGCCTCCCCCGCCGCGCGCCTCCTGCATGCGGGGCCCCAGCTCCGGGCGCCGGCC GGAGCCCCCCCCGGCCGCCCCCGAGCCCCCCGCGCCCCGCGCCGCGCCGCCGCGCCGTCC ATGCACCGCTTGATGGGGGTCAACAGCACCGCCGCCGCCGCCGCCGGGCAGCCCAATGTC TCCTGCACGTGCAACTGCAAACGCTCTTTGTTCCAGAGCATGGAGATCACGGAGCTGGAG TTTGTTCAGATCATCATCATCGTGGTGGTGATGATGGTGATGGTGGTGGTGATCACGTGC CTGCTGAGCCACTACAAGCTGTCTGCACGGTCCTTCATCAGCCGGCACAGCCAGGGGCGG AGGAGAGAAGATGCCCTGTCCTCAGAAGGATGCCTGTGGCCCTCGGAGAGCACAGTGTCA GGCAACGGAATCCCAGAGCCGCAGGTCTACGCCCCGCCTCGGCCCACCGACCGCCTGGCC GTGCCGCCCTTCGCCCAGCGGGAGCGCTTCCACCGCTTCCAGCCCACCTATCCGTACCTG CAGCACGAGATCGACCTGCCGCCCACCATCTCGCTGTCAGACGGGGAGGAGCCCCCACCC TACCAGGGCCCCTGCACCCTCCAGCTTCGGGACCCCGAGCAGCAGCTGGAACTGAACCGG GAGTCGGTGCGCGCACCCCCAAACAGAACCATCTTCGACAGTGACCTGATGGATAGTGCC AGGCTGGGCGGCCCCTGCCCCCCCAGCAGTAACTCGGGCATCAGCGCCACGTGCTACGGC AGCGGCGGGCGCATGGAGGGGCCGCCGCCCACCTACAGCGAGGTCATCGGCCACTACCCG GGGTCCTCCTTCCAGCACCAGCAGAGCAGTGGGCCGCCCTCCTTGCTGGAGGGGACCCGG CTCCACCACACACACATCGCGCCCCTAGAGAGCGCAGCCATCTGGAGCAAAGAGAAGGAT AAACAGAAAGGACACCCTCTCTAGGGTCCCCAGGGGGGCCGGGCTGGGGCTGCGTAGGTG AAAAGGCAGAACACTCCGCGCTTCTTAGAAGAGGAGTGAGAGGAAGGCGGGGGGCGCAGC AACGCATCGTGTGGCCCCTCCCCTCCCACCTCCCTGTGTATAAATATTTACATGTGATGT CTGGTCTGAATGCACAAGCTAAGAGAGCTTGCAAAAAAAAAAAGAAAAAAAAAAAAAAAA AA |
| Restriction Sites | Please inquire |
| ACCN | NM_020182 |
| Insert Size | 1200 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_020182.3, NP_064567.2 |
| RefSeq Size | 4930 bp |
| RefSeq ORF | 864 bp |
| Locus ID | 56937 |
| UniProt ID | Q969W9 |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | This gene encodes a transmembrane protein that contains a Smad interacting motif (SIM). Expression of this gene is induced by androgens and transforming growth factor beta, and the encoded protein suppresses the androgen receptor and transforming growth factor beta signaling pathways though interactions with Smad proteins. Overexpression of this gene may play a role in multiple types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223228 | PMEPA1 (Myc-DDK-tagged)-Human prostate transmembrane protein, androgen induced 1 (PMEPA1), transcript variant 1 |
CNY 3600.00 |
|
| RC223228L3 | Lenti ORF clone of Human prostate transmembrane protein, androgen induced 1 (PMEPA1), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC223228L4 | Lenti ORF clone of Human prostate transmembrane protein, androgen induced 1 (PMEPA1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG223228 | PMEPA1 (tGFP-tagged) - Human prostate transmembrane protein, androgen induced 1 (PMEPA1), transcript variant 1 |
CNY 5200.00 |
