Ocular development associated gene (GATAD1) (AK026142) Human Untagged Clone

CAT#: SC312722

(untagged)-Human cDNA: FLJ22489 fis, clone HRC10951



CNY 9120.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GATAD1 mouse monoclonal antibody, clone OTI1G10 (formerly 1G10)
    • 100 ul

CNY 1999.00
CNY 2700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CMD2B; ODAG; RG083M05.2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK026142, the custom clone sequence may differ by one or more nucleotides
ATGCCGCTGGGCCTGAAGCCCACCTGCAGCGTATGCAAGACCACGTCGTCCTCCATGTGG
AAGAAGGGAGCGCAGGGGGAGATCCTCTGCCATCATTGCACTGGCCGGGGCGGCGCGGGC
AGCGGGGGCGCAGGCTCGGGGGCGGCTGGAGGGACTGGGGGCAGCGGCGGCGGCGGCTTC
GGCGCGGCGACCTTCGCCAGCACCTCCGCCACCCCTCCGCAGAGCAACGGGGGCGGGGGC
GGCAAGCAGAGTAAGCAGGAAATTCACAGGAGGTCTGCTCGGCTCAGAAACACTAAATAC
AAATCTGCTCCGGCTGCTGAAAAGAAAGTCTCCACCAAAGGAAAAGGGAGAAGACATATA
TTTAAATTGAAAAATCCCATCAAAGCTCCTGAGTCAGTTTCCACTATAATCACTGCAGAA
TCAATCTTCTACAAGGGAGTATATTACCAAATTGGTGATGTTGTTTCTGTGATTGATGAA
CAAGATGGAAAGCCCTACTATGCTCAAATCAGAGGTTTTATCCAGGACCAGTATTGCGAG
AAGAGTGCAGCACTGACGTGGCTCATTCCTACCCTCTCTAGCCCCAGAGACCAATTTGAT
CCCGCCTCCTATATCATAGGGCCAGAGGAAGATCTTCCAAGGAAGATGGAATACTTGGAA
TTTGTTTGTCATGCACCTTCTGAGTATTTCAAGTCACGGTCATCACCATTTCCCACAGTT
CCCACCAGACCAGAGAAGGGCTACATATGGACTCATGTTGGGTCTACTCCTGCAATAACA
ATTAAGGAATCAGTTGCCAACCATTTG
Restriction Sites Please inquire     
ACCN AK026142
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq AK026142.1, BAB15374.1
RefSeq Size 1680 bp
RefSeq ORF 1680 bp
Locus ID 57798
Protein Families Transcription Factors
Gene Summary The protein encoded by this gene contains a zinc finger at the N-terminus, and is thought to bind to a histone modification site that regulates gene expression. Mutations in this gene have been associated with autosomal recessive dilated cardiomyopathy. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

其它Ocular development associated gene产品

Customer Reviews 
Loading...