GRHPR (AK026287) Human Untagged Clone

CAT#: SC312654

(untagged)-Human cDNA: FLJ22634 fis, clone HSI06565



CNY 9,120.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
GRHPR mouse monoclonal antibody, clone OTI2H4 (formerly 2H4)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GLXR; GLYD; PH2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK026287, the custom clone sequence may differ by one or more nucleotides
ATGCTGGGTGGTGTCCCTACCCTTTGCGGGACTGGGAACGAGACATGGACTCTCCTTGCT
CTAGGCCAGGCCATTGCTCGGCGTCTGAAACCATTCGGTGTCCAGAGATTTCTGTACACA
GGGCGCCAGCCCAGGCCTGAGGAAGCAGCGGAATTCCAGGCAGAGTTTGTGTCTACCCCT
GAGCTGGCTGCCCAATCTGATTTCATCGTCGTGGCCTGCTCCTTAACACCTGCAACCGAG
GGACTCTGCAACAAGGACTTCTTCCAGAAGATGAAGGAAACAGCTGTGTTCATCAACATC
AGCAGGTATCCTAGGGCCACCTTACCCAGCAAGCCTGGAGAGGAGCCATCCCCACTGCTG
CCATCTGGAGATTTTCTTCCCCGTGGGTTGTTGGTGAGACCCCAGGCTGAGCTTGCTGGT
TTCCATAAACCAAACAACCAACTCAGAAATTCGTGGGAATACACGAGACCTCCGTACAGG
GAAGAAGAGCCGTCAGAGTGGGCCTGGCCTGTCTGCTTCTCAGCAGTGGCCCCCACCCGG
CGGGGCCTGGCACACAGCAGCGTGGCTTCAGGGAGTGTTCCCAGGGAGCCTCTGCAGGCC
CATTATCCTCCACCACAAAGGGCTGGACTTGAGGATCTGAAGGGCCCTCTGGAGGCCGCC
TCCCACACTGCTGAGCCTGGCTTTGTCTGGCTGTGGTTCAGTGATACTTTGAACCTTATG
CTCCTGGGCGGACAGACCCTAAAACTCACGTGGTCG
Restriction Sites Please inquire     
ACCN AK026287
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq AK026287.1, BAB15430.1
RefSeq Size 1612 bp
RefSeq ORF 759 bp
Locus ID 9380
Protein Families Druggable Genome
Protein Pathways Glyoxylate and dicarboxylate metabolism, Metabolic pathways, Pyruvate metabolism
Gene Summary This gene encodes an enzyme with hydroxypyruvate reductase, glyoxylate reductase, and D-glycerate dehydrogenase enzymatic activities. The enzyme has widespread tissue expression and has a role in metabolism. Type II hyperoxaluria is caused by mutations in this gene. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...