TL1A (TNFSF15) (NM_005118) Human Untagged Clone
CAT#: SC312650
TNFSF15 (untagged)-Human tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), transcript variant 1
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | TL1; TL1A; TNLG1B; VEGI; VEGI192A |
| Vector | pCMV6-XL6 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_005118 edited
ATGGCCGAGGATCTGGGACTGAGCTTTGGGGAAACAGCCAGTGTGGAAATGCTGCCAGAG CACGGCAGCTGCAGGCCCAAGGCCAGGAGCAGCAGCGCACGCTGGGCTCTCACCTGCTGC CTGGTGTTGCTCCCCTTCCTTGCAGGACTCACCACATACCTGCTTGTCAGCCAGCTCCGG GCCCAGGGAGAGGCCTGTGTGCAGTTCCAGGCTCTAAAAGGACAGGAGTTTGCACCTTCA CATCAGCAAGTTTATGCACCTCTTAGAGCAGACGGAGATAAGCCAAGGGCACACCTGACA GTTGTGAGACAAACTCCCACACAGCACTTTAAAAATCAGTTCCCAGCTCTGCACTGGGAA CATGAACTAGGCCTGGCCTTCACCAAGAACCGAATGAACTATACCAACAAATTCCTGCTG ATCCCAGAGTCGGGAGACTACTTCATTTACTCCCAGGTCACATTCCGTGGGATGACCTCT GAGTGCAGTGAAATCAGACAAGCAGGCCGACCAAACAAGCCAGACTCCATCACTGTGGTC ATCACCAAGGTAACAGACAGCTACCCTGAGCCAACCCAGCTCCTCATGGGGACCAAGTCT GTGTGCGAAGTAGGTAGCAACTGGTTCCAGCCCATCTACCTCGGAGCCATGTTCTCCTTG CAAGAAGGGGACAAGCTAATGGTGAACGTCAGTGACATCTCTTTGGTGGATTACACAAAA GAAGATAAAACCTTCTTTGGAGCCTTCTTACTATAG |
| Restriction Sites | NotI-NotI |
| ACCN | NM_005118 |
| Insert Size | 2400 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005118.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_005118.2, NP_005109.2 |
| RefSeq Size | 2011 bp |
| RefSeq ORF | 756 bp |
| Locus ID | 9966 |
| UniProt ID | O95150 |
| Domains | TNF |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Cytokine-cytokine receptor interaction |
| Gene Summary | The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein is abundantly expressed in endothelial cells, but is not expressed in either B or T cells. The expression of this protein is inducible by TNF and IL-1 alpha. This cytokine is a ligand for receptor TNFRSF25 and decoy receptor TNFRSF21/DR6. It can activate NF-kappaB and MAP kinases, and acts as an autocrine factor to induce apoptosis in endothelial cells. This cytokine is also found to inhibit endothelial cell proliferation, and thus may function as an angiogenesis inhibitor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (VEGI-251). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212177 | TNFSF15 (Myc-DDK-tagged)-Human tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), transcript variant 1 |
CNY 2400.00 |
|
| RC212177L1 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
| RC212177L2 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC212177L3 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC212177L4 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), transcript variant 1, mGFP tagged |
CNY 4800.00 |
|
| RG212177 | TNFSF15 (tGFP-tagged) - Human tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), transcript variant 1 |
CNY 4000.00 |
