LHFPL2 (NM_005779) Human Untagged Clone
CAT#: SC312544
LHFPL2 (untagged)-Human lipoma HMGIC fusion partner-like 2 (LHFPL2)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC312544 representing NM_005779.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTGTCATGTCATTGTCACCTGTCGCTCGATGCTCTGGACCTTGCTGAGTATTGTGGTGGCTTTTGCC GAGCTCATTGCCTTCATGAGTGCAGACTGGCTGATCGGGAAAGCGAGGAGCCGCGGCGGCGTGGAGCCG GCGGGCCCGGGCGGGGGCTCCCCGGAGCCCTACCACCCCACCCTGGGCATCTACGCCCGCTGCATCCGG AACCCAGGGGTGCAGCACTTCCAGCGGGACACGCTGTGCGGGCCCTACGCCGAGAGCTTCGGCGAGATC GCCAGCGGCTTCTGGCAGGCCACAGCTATTTTCCTGGCTGTGGGAATCTTTATTCTCTGCATGGTGGCC TTGGTGTCCGTCTTCACCATGTGTGTACAGAGCATCATGAAGAAAAGCATCTTCAATGTCTGTGGGCTG TTGCAAGGAATTGCAGGTCTATTCCTTATCCTCGGTTTGATACTCTACCCTGCTGGCTGGGGTTGCCAG AAGGCCATAGACTACTGTGGACATTATGCATCTGCCTACAAACCTGGAGACTGCTCCTTGGGCTGGGCC TTTTATACCGCCATTGGGGGCACAGTCCTCACTTTCATCTGTGCTGTCTTCTCTGCACAAGCAGAAATT GCAACCTCTAGTGACAAAGTACAGGAAGAAATTGAAGAGGGGAAAAATCTGATCTGCCTCCTTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_005779 |
| Insert Size | 687 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_005779.2 |
| RefSeq Size | 5061 bp |
| RefSeq ORF | 687 bp |
| Locus ID | 10184 |
| UniProt ID | Q6ZUX7 |
| Protein Families | Transmembrane |
| MW | 24.5 kDa |
| Gene Summary | This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in one LHFP-like gene result in deafness in humans and mice, and a second LHFP-like gene is fused to a high-mobility group gene in a translocation-associated lipoma. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214880 | LHFPL2 (Myc-DDK-tagged)-Human lipoma HMGIC fusion partner-like 2 (LHFPL2) |
CNY 2400.00 |
|
| RC214880L3 | Lenti ORF clone of Human lipoma HMGIC fusion partner-like 2 (LHFPL2), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC214880L4 | Lenti ORF clone of Human lipoma HMGIC fusion partner-like 2 (LHFPL2), mGFP tagged |
CNY 5890.00 |
|
| RG214880 | LHFPL2 (tGFP-tagged) - Human lipoma HMGIC fusion partner-like 2 (LHFPL2) |
CNY 4370.00 |
