HOXC5 (NM_018953) Human Untagged Clone

CAT#: SC312516

HOXC5 (untagged)-Human homeobox C5 (HOXC5), transcript variant 1



  "NM_018953" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


HOXC5 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CP11; HOX3; HOX3D
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312516 representing NM_018953.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCTCCTACGTAGCCAATTCATTCTATAAGCAGAGCCCCAATATCCCTGCCTATAACATGCAAACT
TGTGGGAACTATGGATCGGCCTCAGAGGTGCAGGCATCCAGGTACTGCTACGGCGGATTGGACTTAAGC
ATCACTTTCCCACCGCCTGCGCCTTCCAACTCTCTCCACGGGGTAGACATGGCTGCCAACCCCCGGGCT
CACCCCGACCGCCCCGCCTGCAGCGCCGCGGCCGCTCCGGGACACGCTCCGGGCAGAGACGAAGCGGCT
CCTCTGAACCCCGGGATGTACAGTCAGAAGGCGGCTCGCCCGGCGCTGGAGGAGCGAGCTAAGAGCAGT
GGGGAGATCAAAGAGGAGCAGGCGCAGACAGGGCAGCCCGCCGGACTGAGCCAGCCACCGGCCCCGCCA
CAGATTTACCCGTGGATGACCAAACTGCACATGAGCCACGAGACGGACGGCAAGCGGTCCCGAACCAGT
TACACGCGCTACCAGACTCTGGAACTCGAGAAAGAATTCCACTTTAACCGCTACCTCACTCGCCGCAGG
CGCATAGAGATCGCCAACAACTTGTGTCTCAATGAGAGACAGATCAAGATCTGGTTCCAGAACCGCAGG
ATGAAGTGGAAGAAAGATTCCAAAATGAAAAGCAAAGAGGCTCTTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_018953
Insert Size 669 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_018953.3
RefSeq Size 1645 bp
RefSeq ORF 669 bp
Locus ID 3222
UniProt ID Q00444
Domains homeobox
Protein Families Transcription Factors
MW 25 kDa
Gene Summary This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene, HOXC5, is one of several homeobox HOXC genes located in a cluster on chromosome 12. Three genes, HOXC5, HOXC4 and HOXC6, share a 5' non-coding exon. Transcripts may include the shared exon spliced to the gene-specific exons, or they may include only the gene-specific exons. Two alternatively spliced variants have been described for HOXC5. The transcript variant which includes the shared exon apparently doesn't encode a protein. The protein-coding transcript variant contains gene-specific exons only. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the shorter transcript and is protein coding.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...