SENP3 (AK000923) Human Untagged Clone

CAT#: SC312388

(untagged)-Human cDNA FLJ10061 fis, clone HEMBA1001413



CNY 9120.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-SENP3 Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SMT3IP1; SSP3; Ulp1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK000923, the custom clone sequence may differ by one or more nucleotides
ATGAGTAGGAACTCTCTCTCCATCCCTGTAGAATCTCTTGGACATGTTTATCTCATGCTT
ATGGGGTCCCCATTTCTTGGAGTGGGATTGACATTGGTGGATTCTGCTTCAGTGTATCCT
TCTTGCGGTCTTATTTGCATGCATGAGTCAACTGTGTGCATCCCATTGTGCTTTCCCCAG
GCCAGTCTCTCATGCCCATTCCATTTCCCCTGCCCTATAGGCCTCCTTTCATGTACTCTG
CCCAACGGTTTTGGGGGACAATCTGGGCCAGAAGGGGAGCGCAGCTTGGCACCCCCTGAT
GCCAGCATCCTCATCAGCAATGTGTGCAGCATCGGGGACCATGTGGCCCAGGAGCTTTTT
CAGGGCTCAGATTTGGGCATGGCAGAAGAGGCAGAGAGGCCTGGGGAGAAAGCCGGCCAG
CACAGCCCCCTGCGAGAGGAGCATGTGACCTGCGTACAGAGCATCTTGGACGAATTCCTT
CAAACGTATGGCAGCCTCATACCCCTCAGCACTGATGAGGTAGTAGAGAAGCTGGAGGAC
ATTTTCCAGCAGGAGTTTTCCACCCCTTCCAGG
Restriction Sites Please inquire     
ACCN AK000923
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq AK000923.1
RefSeq Size 1578 bp
RefSeq ORF 1578 bp
Locus ID 26168
Protein Families Druggable Genome, Protease
Gene Summary The reversible posttranslational modification of proteins by the addition of small ubiquitin-like SUMO proteins (see SUMO1; MIM 601912) is required for numerous biologic processes. SUMO-specific proteases, such as SENP3, are responsible for the initial processing of SUMO precursors to generate a C-terminal diglycine motif required for the conjugation reaction. They also have isopeptidase activity for the removal of SUMO from high molecular mass SUMO conjugates (Di Bacco et al., 2006 [PubMed 16738315]).[supplied by OMIM, Jun 2009]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...