RASSF1 (NM_170712) Human Untagged Clone

CAT#: SC312380

RASSF1 (untagged)-Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant B



  "NM_170712" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
RASSF1 mouse monoclonal antibody, clone OTI2B11 (formerly 2B11)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 123F2; NORE2A; RASSF1A; RDA32; REH3P21
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312380 representing NM_170712.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCTTGAACAAGGACGGTTCTTACACAGGCTTCATCAAGGTTCAGCTGAAGCTGGTGCGCCCTGTC
TCTGTGCCCTCCAGCAAGAAGCCACCCTCCTTGCAGGATGCCCGGCGGGGCCCAGGACGGGGCACAAGT
GTCAGGCGCCGCACTTCCTTTTACCTGCCCAAGGATGCTGTCAAGCACCTGCATGTGCTGTCACGCACA
AGGGCACGTGAAGTCATTGAGGCCCTGCTGCGAAAGTTCTTGGTGGTGGATGACCCCCGCAAGTTTGCA
CTCTTTGAGCGCGCTGAGCGTCACGGCCAAGTGTACTTGCGGAAGCTGTTGGATGATGAGCAGCCCCTG
CGGCTGCGGCTCCTGGCAGGGCCCAGTGACAAGGCCCTGAGCTTTGTCCTGAAGGAAAATGACTCTGGG
GAGGTGAACTGGGACGCCTTCAGCATGCCTGAACTACATAACTTCCTACGTATCCTGCAGCGGGAGGAG
GAGGAGCACCTCCGCCAGATCCTGCAGAAGTACTCCTATTGCCGCCAGAAGATCCAAGAGGCCCTGCAC
GCCTGCCCCCTTGGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_170712
Insert Size 570 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_170712.2
RefSeq Size 1676 bp
RefSeq ORF 570 bp
Locus ID 11186
UniProt ID Q9NS23
Protein Families Druggable Genome
Protein Pathways Bladder cancer, Non-small cell lung cancer, Pathways in cancer
MW 21.9 kDa
Gene Summary This gene encodes a protein similar to the RAS effector proteins. Loss or altered expression of this gene has been associated with the pathogenesis of a variety of cancers, which suggests the tumor suppressor function of this gene. The inactivation of this gene was found to be correlated with the hypermethylation of its CpG-island promoter region. The encoded protein was found to interact with DNA repair protein XPA. The protein was also shown to inhibit the accumulation of cyclin D1, and thus induce cell cycle arrest. Several alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, May 2011]
Transcript Variant: This variant (B) differs in the 5' end region compared to variant D. The resulting isoform (B) has a shorter N-terminus, as compared to isoform D. Variants B and H both encode the same isoform (B).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...