SERAC1 (BC028594) Human Untagged Clone
CAT#: SC312282
SERAC1 (untagged)-Homo sapiens, Similar to hypothetical protein FLJ14917, clone IMAGE:4824353
CNY 9120.00
货期*
4周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 4930511N22Rik; D17Ertd141e; FLJ14917; OTTMUSP00000028541; serine active site containing 1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for BC028594, the custom clone sequence may differ by one or more nucleotides
ATGTCCCTGGCTGCTTATTGCGTCATCTGTTGCAGAAGAATAGGAACCTCTACTTCCCCA CCAAAAAGTGGCACACACTGGAGAGATATCAGAAATATAATAAAGTTTACTGGATCACTT ATTTTAGGAGGTTCTTTACTTCTTACATATGAAGTTCTGGCCCTGAAGAAGGCTGTGACA TTAGATACTCAAGTGGTAGAACGAGAAAAAATGAAGTCATATATATATGTGCACACAGTT TCTTTAGATAAAGGAGAAAATCATGGTATTGCCTGGCAGGCAAGAAAAGAACTTCACAAA GCAGTAAGAAAAGTATTGGCAACATCAGCCAAGATACTGCGGAATCCATTTGCTGATCCT TTTAGTACAGTTGATATAGAAGATCATGAGTGTGCTGTGTGGCTGCTCCTACGGAAGAGC AAGTCAGATGACAAAACCACGCGACTCGAGGCTGTGCGGGAAATGTCGGAGACCCATCAC TGGCATGGTAATGAGACTACC |
Restriction Sites | Please inquire |
ACCN | BC028594 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC028594.1, AAH28594.1 |
RefSeq Size | 4705 bp |
RefSeq ORF | 504 bp |
Locus ID | 84947 |
Gene Summary | The protein encoded by this gene is a phosphatidylglycerol remodeling protein found at the interface of mitochondria and endoplasmic reticula, where it mediates phospholipid exchange. The encoded protein plays a major role in mitochondrial function and intracellular cholesterol trafficking. Defects in this gene are a cause of 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL). Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...