C17orf27 (RNF213) (AF318359) Human Untagged Clone
CNY 9120.00
货期*
4周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for AF318359, the custom clone sequence may differ by one or more nucleotides
ATGATGAGCCACCAGTCAGTTCTGCAGATGTGTCCCCGAGCTCCTGCCGAGGGACGAAAC ACGGTGGCCCTGCTCCTAGTGCCATGTGCACGCCACGCTCCACACCTGCCATCTGCCCTT CCACCACCTGCTCCCCCAGGGGCTCCGCCTCGTGACTCACGCTCAGGCAAGTCTCCGGGC GCGAACAGCTGGCTGATGGTGACATGCTGCAGCCTGGTCACATCAGAAACCATGAGGGTG GATCTCCGGAGGTCATCGATGTGGACAGACTGCCACAGCCCTGTGAAGAGTGAAGCCACC CACAACTGTCTTTGTGTCTTTCCCGGCTGCTGCTCAGCCCTAAGCAGGGACATTGCACAC CCTGGCTTGTCATTATCTTGCTGCGCAATGAATGACTGGCACCCTGAAGCCGAAACCCTG GAATGGGCCTGCGCAGAAACCACCCAACCCGATACTATACACGACCCGATTCTATGCCCA TCGACAGCTTCACCA |
Restriction Sites | Please inquire |
ACCN | AF318359 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | AF318359.1, AAL55866.1 |
RefSeq Size | 2000 bp |
RefSeq ORF | 498 bp |
Locus ID | 57674 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它C17orf27产品
Customer
Reviews
Loading...