FAM89B (BC023991) Human Untagged Clone
CNY 9120.00
货期*
4周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | family with sequence similarity 89, member B; mammary turmor virus receptor homolog 1; MTVR1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for BC023991, the custom clone sequence may differ by one or more nucleotides
ATGAACGGGCTGCCCTCGGCAGAGGCGCCGGGCGGGGCGGGCTGCGCTTTGGCCGGGCTC CCACCGCTGCCGCGCGGCCTCAGCGGCCTCCTTAATGCGAGCGGGGGCTCGTGGCGGGAG CTGGAGCGCGTCTACAGCCAGCGCAGCCGCGTCGTCCTGTCAACCTCGACTCAGCGCTGG CCGCGCTGCGCAAGGAGATGTTGTCTGCAGGTGGGGCTGCGGCAGTTGGACATGTCCTTG TTGTGCCAGCTGTGGGGCCTGTACGAGTCAATCCAGGACTACAAACACCTGTGCCAAGAC CTGAGCTTCTGCCAGGACCTGTCATCCTCCCTCCATTCGGACAGCTCCTACCCACCGGAT GCGGGCCTGTCTGACGACGAGGAGCCTCCCGATGCCAGCCTGCCTCCTGACCCGCCACCC CTTACTGTGCCCCAGACGCACAATGCCCGTGACCAGTGGCTGCAGGATGCCTTCCACATC AGCCTC |
Restriction Sites | Please inquire |
ACCN | BC023991 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC023991.2, AAH23991.1 |
RefSeq Size | 1900 bp |
RefSeq ORF | 489 bp |
Locus ID | 23625 |
Protein Families | Druggable Genome |
Gene Summary | Negatively regulates TGF-beta-induced signaling; in cooperation with SKI prevents the translocation of SMAD2 from the nucleus to the cytoplasm in response to TGF-beta. Acts as an adapter that mediates the specific recognition of LIMK1 by CDC42BPA and CDC42BPB in the lamellipodia. LRAP25-mediated CDC42BPA/CDC42BPB targeting to LIMK1 and the lamellipodium results in LIMK1 activation and the subsequent phosphorylation of CFL1 which is important for lamellipodial F-actin regulation.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...