SNAP23 (NM_130798) Human Untagged Clone
CAT#: SC312220
SNAP23 (untagged)-Human synaptosomal-associated protein, 23kDa (SNAP23), transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HsT17016; SNAP-23; SNAP23A; SNAP23B |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC312220 representing NM_130798.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGATAATCTGTCATCAGAAGAAATTCAACAGAGAGCTCACCAGATTACTGATGAGTCTCTGGAAAGT ACGAGGAGAATCCTGGGTTTAGCCATTGAGTCTCAGGATGCAGGAATCAAGACCATCACTATGCTGGAT GAACAAAAGGAACAACTAAACCGCATAGAAGAAGGCTTGGACCAAATAAATAAGGACATGAGAGAGACA GAGAAGACTTTAACAGAACTCAACAAATGCTGTGGCCTTTGTGTCTGCCCATGTAATAGCATAACTAAT GATGCCAGAGAAGATGAAATGGAAGAGAACCTGACTCAAGTGGGCAGTATCCTGGGAAATCTAAAAGAC ATGGCCCTGAACATAGGCAATGAGATTGATGCTCAAAATCCACAAATAAAACGAATCACAGACAAGGCT GACACCAACAGAGATCGTATTGATATTGCCAATGCCAGAGCAAAGAAACTCATTGACAGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_130798 |
Insert Size | 477 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_130798.2 |
RefSeq Size | 2491 bp |
RefSeq ORF | 477 bp |
Locus ID | 8773 |
UniProt ID | O00161 |
Domains | t_SNARE |
Protein Families | Druggable Genome |
Protein Pathways | SNARE interactions in vesicular transport |
MW | 17.8 kDa |
Gene Summary | Specificity of vesicular transport is regulated, in part, by the interaction of a vesicle-associated membrane protein termed synaptobrevin/VAMP with a target compartment membrane protein termed syntaxin. These proteins, together with SNAP25 (synaptosome-associated protein of 25 kDa), form a complex which serves as a binding site for the general membrane fusion machinery. Synaptobrevin/VAMP and syntaxin are believed to be involved in vesicular transport in most, if not all cells, while SNAP25 is present almost exclusively in the brain, suggesting that a ubiquitously expressed homolog of SNAP25 exists to facilitate transport vesicle/target membrane fusion in other tissues. The protein encoded by this gene is structurally and functionally similar to SNAP25 and binds tightly to multiple syntaxins and synaptobrevins/VAMPs. It is an essential component of the high affinity receptor for the general membrane fusion machinery and is an important regulator of transport vesicle docking and fusion. Two alternative transcript variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks internal exon 6 but maintains the same reading frame as compared to transcript variant 1. It encodes an isoform (SNAP23B) which is missing 53 aa as compared to the full-length isoform (SNAP23A) encoded by transcript variant 1. The missing region is required for nonspecific binding of the protein to plasma membranes, indicating a functional difference between isoforms SNAP23A and SNAP23B. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217287 | SNAP23 (Myc-DDK-tagged)-Human synaptosomal-associated protein, 23kDa (SNAP23), transcript variant 2 |
CNY 1200.00 |
|
RC217287L3 | Lenti ORF clone of Human synaptosomal-associated protein, 23kDa (SNAP23), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC217287L4 | Lenti ORF clone of Human synaptosomal-associated protein, 23kDa (SNAP23), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG217287 | SNAP23 (tGFP-tagged) - Human synaptosomal-associated protein, 23kDa (SNAP23), transcript variant 2 |
CNY 4370.00 |