ATP dependent metalloprotease YME1L1 (YME1L1) (BC019602) Human Untagged Clone
CNY 9120.00
货期*
4周
规格
Product images

推荐一起购买 (4)
YME1L1 mouse monoclonal antibody, clone OTI2G10 (formerly 2G10)
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FTSH; MEG4; PAMP; YME1L |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for BC019602, the custom clone sequence may differ by one or more nucleotides
ATGTTTTCCTTGTCGAGCACGGTGCAACCCCAGGTTACAGTTCCTCTGAGTCATCTCATC AATGCCTTCCATACACCAAAAAACACTTCTGTTTCTCTCAGTGGAGTGTCAGTTTCTCAA AACCAGCATCGAGATGTAGTTCCTGAGCATGAGGCTCCCAGCAGTGAGTGTATGTTCAGT GACTTCCTGACGAAGCTTAACATTGTTTCAATTGGCAAAGGAAAAATATTCGAAGGGTAC AGATCCATGTTCATGGAGCCAGCAAAAAGGATGAAGAAGAGCTTGGACACAACCGATAAC TGGCACATCCGTCCAGAACCCTTCTCCCTCTCAATCCCTGTACACTGCGGGTTTCTCCAA ATGCCTATTGTCTATGATTTGTTTTGTCCATCGTTCTTAGTCACGGCT |
Restriction Sites | Please inquire |
ACCN | BC019602 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC019602.1, AAH19602.1 |
RefSeq Size | 2563 bp |
RefSeq ORF | 411 bp |
Locus ID | 10730 |
Protein Families | Druggable Genome, Protease |
Gene Summary | The protein encoded by this gene is the human ortholog of yeast mitochondrial AAA metalloprotease, Yme1p. It is localized in the mitochondria and can functionally complement a yme1 disruptant yeast strain. It is proposed that this gene plays a role in mitochondrial protein metabolism and could be involved in mitochondrial pathologies. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它ATP dependent metalloprotease YME1L1产品
Customer
Reviews
Loading...