FOXK1 (AK097109) Human Untagged Clone

CAT#: SC311976

(untagged)-Human cDNA FLJ39790 fis, clone SPLEN2003204



CNY 9120.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-FOXK1 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK097109, the custom clone sequence may differ by one or more nucleotides
ATGTGGTTTTGCAGAAACATACCCCCTCTCTGCTCCAGCTTCAGTCGTCAGTATCCAGCT
ACTTCCAAGAGTCTTGCCCATGTCTTGTGGGATGTTCAGCAAATGTATAAACACTTAATA
TCCCGACAAAGCTTGGCCTCTTCCCTCCCAAATTACTTCCCAGGCTATGCACCCGTTTTT
GTTAATACAACCAACTTGGAAACTTTGATGTCAGATTTGATGCCCTTTCTTGCCTTTCCA
TGCTCCAATCACTTGCCAAGTCCTGTCGATTGTACCCCTACAGTAATTCTTGCATCTTCT
TACCCACTGCCCCCACCTAATCAACGTTCTCATTACCATCCCCTGCACGGTGTCAGTGCA
GTACCTTTCTCATTGATGTCCTGCCTC
Restriction Sites Please inquire     
ACCN AK097109
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq AK097109.1
RefSeq Size 2064 bp
RefSeq ORF 2064 bp
Locus ID 221937
Gene Summary Transcriptional regulator involved in different processes such as glucose metabolism, aerobic glycolysis, muscle cell differentiation and autophagy (By similarity). Recognizes and binds the forkhead DNA sequence motif (5'-GTAAACA-3') and can both act as a transcription activator or repressor, depending on the context (PubMed:17670796). Together with FOXK2, acts as a key regulator of metabolic reprogramming towards aerobic glycolysis, a process in which glucose is converted to lactate in the presence of oxygen (By similarity). Acts by promoting expression of enzymes for glycolysis (such as hexokinase-2 (HK2), phosphofructokinase, pyruvate kinase (PKLR) and lactate dehydrogenase), while suppressing further oxidation of pyruvate in the mitochondria by up-regulating pyruvate dehydrogenase kinases PDK1 and PDK4 (By similarity). Probably plays a role in gluconeogenesis during overnight fasting, when lactate from white adipose tissue and muscle is the main substrate (By similarity). Involved in mTORC1-mediated metabolic reprogramming: in response to mTORC1 signaling, translocates into the nucleus and regulates the expression of genes associated with glycolysis and downstream anabolic pathways, such as HIF1A, thereby regulating glucose metabolism (By similarity). Together with FOXK2, acts as a negative regulator of autophagy in skeletal muscle: in response to starvation, enters the nucleus, binds the promoters of autophagy genes and represses their expression, preventing proteolysis of skeletal muscle proteins (By similarity). Acts as a transcriptional regulator of the myogenic progenitor cell population in skeletal muscle (By similarity). Binds to the upstream enhancer region (CCAC box) of myoglobin (MB) gene, regulating the myogenic progenitor cell population (By similarity). Promotes muscle progenitor cell proliferation by repressing the transcriptional activity of FOXO4, thereby inhibiting myogenic differentiation (By similarity). Involved in remodeling processes of adult muscles that occur in response to physiological stimuli (By similarity). Required to correct temporal orchestration of molecular and cellular events necessary for muscle repair (By similarity). Represses myogenic differentiation by inhibiting MEFC activity (By similarity). Positively regulates Wnt/beta-catenin signaling by translocating DVL into the nucleus (PubMed:25805136). Reduces virus replication, probably by binding the interferon stimulated response element (ISRE) to promote antiviral gene expression (PubMed:25852164).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...