ZNF326 (NM_182975) Human Untagged Clone
CAT#: SC311529
ZNF326 (untagged)-Human zinc finger protein 326 (ZNF326), transcript variant 3
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | dJ871E2.1; ZAN75; Zfp326; ZIRD |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC311529 representing NM_182975.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACTTCGAGGACGATTACACACACTCCGCCTGCAGGAATACTTATCAGGGCTTTAATGGAATGGAT CGTGATTATGGCCCTGGATCTTATGGAGGGATGGATCGTGACTATGGCCATGGATCCTATGGGGGTCAG AGATCCATGGATTCCTACCTAAACCAGTCATATGGCATGGACAATCACAGTGGTGGTGGTGGGGGTAGC AGGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_182975 |
Insert Size | 213 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_182975.3 |
RefSeq Size | 1611 bp |
RefSeq ORF | 213 bp |
Locus ID | 284695 |
UniProt ID | Q5BKZ1 |
Protein Families | Transcription Factors |
MW | 7.7 kDa |
Gene Summary | Core component of the DBIRD complex, a multiprotein complex that acts at the interface between core mRNP particles and RNA polymerase II (RNAPII) and integrates transcript elongation with the regulation of alternative splicing: the DBIRD complex affects local transcript elongation rates and alternative splicing of a large set of exons embedded in (A + T)-rich DNA regions. May play a role in neuronal differentiation and is able to bind DNA and activate expression in vitro.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) uses an alternate 3' exon structure and differs in the 3' UTR and 3' coding region, compared to variant 1. The resulting isoform (3) has a shorter C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222780 | ZNF326 (Myc-DDK-tagged)-Human zinc finger protein 326 (ZNF326), transcript variant 3 |
CNY 1200.00 |
|
RC222780L3 | Lenti ORF clone of Human zinc finger protein 326 (ZNF326), transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
RC222780L4 | Lenti ORF clone of Human zinc finger protein 326 (ZNF326), transcript variant 3, mGFP tagged |
CNY 3600.00 |
|
RG222780 | ZNF326 (tGFP-tagged) - Human zinc finger protein 326 (ZNF326), transcript variant 3 |
CNY 4370.00 |