ZNF326 (NM_182975) Human Untagged Clone

CAT#: SC311529

ZNF326 (untagged)-Human zinc finger protein 326 (ZNF326), transcript variant 3



  "NM_182975" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-ZNF326 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ871E2.1; ZAN75; Zfp326; ZIRD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC311529 representing NM_182975.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACTTCGAGGACGATTACACACACTCCGCCTGCAGGAATACTTATCAGGGCTTTAATGGAATGGAT
CGTGATTATGGCCCTGGATCTTATGGAGGGATGGATCGTGACTATGGCCATGGATCCTATGGGGGTCAG
AGATCCATGGATTCCTACCTAAACCAGTCATATGGCATGGACAATCACAGTGGTGGTGGTGGGGGTAGC
AGGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_182975
Insert Size 213 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_182975.3
RefSeq Size 1611 bp
RefSeq ORF 213 bp
Locus ID 284695
UniProt ID Q5BKZ1
Protein Families Transcription Factors
MW 7.7 kDa
Gene Summary Core component of the DBIRD complex, a multiprotein complex that acts at the interface between core mRNP particles and RNA polymerase II (RNAPII) and integrates transcript elongation with the regulation of alternative splicing: the DBIRD complex affects local transcript elongation rates and alternative splicing of a large set of exons embedded in (A + T)-rich DNA regions. May play a role in neuronal differentiation and is able to bind DNA and activate expression in vitro.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate 3' exon structure and differs in the 3' UTR and 3' coding region, compared to variant 1. The resulting isoform (3) has a shorter C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...