INS-IGF2 (NM_001042376) Human Untagged Clone
CAT#: SC311232
INS (untagged)-Human INS-IGF2 readthrough (INS-IGF2), transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | INSIGF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC311232 representing NM_001042376.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCA GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGA GGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGCCTCAGCTTTGTCCCTCTCC TCCTCCACGTCAACCTGGCCAGAGGGTCTGGACGCCACAGCCAGGGCACCCCCTGCTTTGGTGGTGACT GCTAATATTGGCCAGGCCGGCGGATCATCGTCCAGGCAGTTTCGGCAGAGAGCCTTGGGCACCAGTGAC TCCCCGGTCCTCTTTATCCACTGTCCAGGAGCTGCGGGGACTGCGCAGGGACTAGAGTACAGGGGCCGA AGAGTCACCACCGAGCTTGTGTGGGAGGAGGTGGATTCCAGCCCCCAGCCCCAGGGCTCTGAATCGCTG CCAGCTCAGCCCCCTGCCCAGCCTGCCCCACAGCCTGAGCCCCAGCAGGCCAGAGAGCCCAGTCCTGAG GTGAGCTGCTGTGGCCTGTGGCCCAGGCGACCCCAGCGCTCCCAGAACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001042376 |
Insert Size | 603 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001042376.2 |
RefSeq Size | 847 bp |
RefSeq ORF | 603 bp |
Locus ID | 723961 |
UniProt ID | F8WCM5 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein |
MW | 21.5 kDa |
Gene Summary | This locus includes two alternatively spliced read-through transcript variants which align to the INS gene in the 5' region and to the IGF2 gene in the 3' region. One transcript is predicted to encode a protein which shares the N-terminus with the INS protein but has a distinct and longer C-terminus, whereas the other transcript is a candidate for nonsense-mediated decay (NMD). The transcripts are imprinted and are paternally expressed in the limb and eye. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2, also known as INSIGF short) represents the shorter transcript and is protein-coding. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220218 | INS (Myc-DDK-tagged)-Human INS-IGF2 readthrough (INS-IGF2), transcript variant 2 |
CNY 2400.00 |
|
RC220218L3 | Lenti ORF clone of Human INS-IGF2 readthrough (INS-IGF2), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC220218L4 | Lenti ORF clone of Human INS-IGF2 readthrough (INS-IGF2), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG220218 | INS (tGFP-tagged) - Human INS-IGF2 readthrough (INS-IGF2), transcript variant 2 |
CNY 4370.00 |
其它INS-IGF2产品