PTPN20B (PTPN20) (NM_001042365) Human Untagged Clone
CAT#: SC311213
PTPN20B (untagged)-Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 10
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bA42B19.1; bA142I17.1; CT126; PTPN20A; PTPN20B |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001042365, the custom clone sequence may differ by one or more nucleotides
ATGTGGACAGCCAGAGGCCCCTTCAGAAGAGACAGGTGGAGCAGTGAGGATGAGGAGGCT GCAGGGCCATCACAGGCTCTCTCCCCTCTACTTTCTGTTCAACATCATGGATATAGTGGC CCAAATGAGAGAACAACGTTCTGGCATGGTTCAAACGAAGGAGCAGTATCACTTTTGTTA CGATATTGTGCTTGA |
Restriction Sites | Please inquire |
ACCN | NM_001042365 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001042365.2, NP_001035824.1 |
RefSeq Size | 1885 bp |
RefSeq ORF | 195 bp |
Locus ID | 26095 |
Protein Families | Druggable Genome, Phosphatase |
Gene Summary | The product of this gene belongs to the family of classical tyrosine-specific protein tyrosine phosphatases. Many protein tyrosine phosphatases have been shown to regulate fundamental cellular processes. The encoded protein appears to be targeted to sites of actin polymerization. A pseudogene of this gene has been defined on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (10) differs in the 5' UTR and has multiple coding region differences, compared to variant 1, one of which results in a frameshift. These differences cause translation initiation at a downstream AUG and a protein (isoform 10) with a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223428 | PTPN20B (Myc-DDK-tagged)-Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 10 |
CNY 3990.00 |
|
RC223428L3 | Lenti-ORF clone of PTPN20B (Myc-DDK-tagged)-Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 10 |
CNY 5890.00 |
|
RC223428L4 | Lenti-ORF clone of PTPN20B (mGFP-tagged)-Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 10 |
CNY 5890.00 |
|
RG223428 | PTPN20B (tGFP-tagged) - Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 10 |
CNY 4370.00 |
其它PTPN20B产品