TMEM70 (NM_001040613) Human Untagged Clone

CAT#: SC311205

TMEM70 (untagged)-Human transmembrane protein 70 (TMEM70), nuclear gene encoding mitochondrial protein, transcript variant 2



  "NM_001040613" in other vectors (4)

CNY 3990.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal TMEM70 Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MC5DN2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001040613 edited
ATGCTGTTTCTGGCGTTGGGCAGCCCGTGGGCGGTCGAACTGCCTCTCTGCGGAAGGAGG
ACTGCATTGTGTGCGGCCGCCGCGCTCCGAGGTCCCCGGCCCTCTGTCTCCCGGGCGTCC
TCCAGCAGCGGGCCTTCGGGGCCGGTAGCCGGCTGGAGTACGGGGCCTTCGGGAGCCGCG
CGCCTTCTCCGGCGTCCGGGTCGAGCGCAGATCCCTGTTTATTGGGAAGGATATGTTCGA
TTCTTAAATACGCCATCTGACAAATCAGAAGATGGAAGGCTAATTTATACTGGCAATATG
GCCCGAGCAGTGTTTGGTAAGTAA
Restriction Sites NotI-NotI     
ACCN NM_001040613
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation It is not a varient.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001040613.1, NP_001035703.1
RefSeq Size 2044 bp
RefSeq ORF 324 bp
Locus ID 54968
UniProt ID Q9BUB7
Protein Families Transmembrane
Gene Summary This gene likely encodes a mitochondrial membrane protein. The encoded protein may play a role in biogenesis of mitochondrial ATP synthase. Mutations in this gene have been associated with neonatal mitochondrial encephalocardiomyopathy due to ATP synthase deficiency. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform b, which has a shorter and distinct C-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...