TMEM70 (NM_001040613) Human Untagged Clone
CAT#: SC311205
TMEM70 (untagged)-Human transmembrane protein 70 (TMEM70), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MC5DN2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001040613 edited
ATGCTGTTTCTGGCGTTGGGCAGCCCGTGGGCGGTCGAACTGCCTCTCTGCGGAAGGAGG ACTGCATTGTGTGCGGCCGCCGCGCTCCGAGGTCCCCGGCCCTCTGTCTCCCGGGCGTCC TCCAGCAGCGGGCCTTCGGGGCCGGTAGCCGGCTGGAGTACGGGGCCTTCGGGAGCCGCG CGCCTTCTCCGGCGTCCGGGTCGAGCGCAGATCCCTGTTTATTGGGAAGGATATGTTCGA TTCTTAAATACGCCATCTGACAAATCAGAAGATGGAAGGCTAATTTATACTGGCAATATG GCCCGAGCAGTGTTTGGTAAGTAA |
Restriction Sites | NotI-NotI |
ACCN | NM_001040613 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | It is not a varient. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001040613.1, NP_001035703.1 |
RefSeq Size | 2044 bp |
RefSeq ORF | 324 bp |
Locus ID | 54968 |
UniProt ID | Q9BUB7 |
Protein Families | Transmembrane |
Gene Summary | This gene likely encodes a mitochondrial membrane protein. The encoded protein may play a role in biogenesis of mitochondrial ATP synthase. Mutations in this gene have been associated with neonatal mitochondrial encephalocardiomyopathy due to ATP synthase deficiency. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform b, which has a shorter and distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217140 | TMEM70 (Myc-DDK-tagged)-Human transmembrane protein 70 (TMEM70), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 1200.00 |
|
RC217140L3 | Lenti ORF clone of Human transmembrane protein 70 (TMEM70), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC217140L4 | Lenti ORF clone of Human transmembrane protein 70 (TMEM70), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG217140 | TMEM70 (tGFP-tagged) - Human transmembrane protein 70 (TMEM70), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 2800.00 |