Acid Phosphatase (ACP1) (NM_001040649) Human Untagged Clone
CAT＃: SC311204
ACP1 (untagged)-Human acid phosphatase 1, soluble (ACP1), transcript variant 4
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HAAP; LMW-PTP; LMWPTP |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001040649 edited
ATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCTGGGTAACATTTGTCGATCA CCCATTGCAGAAGCAGTTTTCAGGAAACTTGTAACCGATCAAAACATCTCAGAGAATTGG AGGGTAGACAGCGCGGCAACTTCCGGGTATGAGATAGGGAACCCCCCTGACTACCGAGGG CAGAGCTGCATGAAGAGGCACGGCATTCCCATGAGCCACGTTGCCCGGCAGGTACCGTCC TTGGACTTGAAGTTGTGTGTTTTGTGTTTCAGTGGGTCATTGACAGCGGTGCTGTTTCTG ACTGGAACGTGGGCCGGTCCCCAGACCCAAGAGCTGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001040649 |
| Insert Size | 5200 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001040649.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001040649.1, NP_001035739.1 |
| RefSeq Size | 655 bp |
| RefSeq ORF | 339 bp |
| Locus ID | 52 |
| Protein Families | Druggable Genome, Phosphatase, Transmembrane |
| Protein Pathways | Adherens junction, Riboflavin metabolism |
| Gene Summary | The product of this gene belongs to the phosphotyrosine protein phosphatase family of proteins. It functions as an acid phosphatase and a protein tyrosine phosphatase by hydrolyzing protein tyrosine phosphate to protein tyrosine and orthophosphate. This enzyme also hydrolyzes orthophosphoric monoesters to alcohol and orthophosphate. This gene is genetically polymorphic, and three common alleles segregating at the corresponding locus give rise to six phenotypes. Each allele appears to encode at least two electrophoretically different isozymes, Bf and Bs, which are produced in allele-specific ratios. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Aug 2008] Transcript Variant: This variant (4) represents the shortest transcript and encodes the shortest isoform (d). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212157 | ACP1 (Myc-DDK-tagged)-Human acid phosphatase 1, soluble (ACP1), transcript variant 4 |
CNY 1800.00 |
|
| RC212157L3 | Lenti-ORF clone of ACP1 (Myc-DDK-tagged)-Human acid phosphatase 1, soluble (ACP1), transcript variant 4 |
CNY 5890.00 |
|
| RC212157L4 | Lenti-ORF clone of ACP1 (mGFP-tagged)-Human acid phosphatase 1, soluble (ACP1), transcript variant 4 |
CNY 5890.00 |
|
| RG212157 | ACP1 (tGFP-tagged) - Human acid phosphatase 1, soluble (ACP1), transcript variant 4 |
CNY 4370.00 |
其它Acid Phosphatase产品
