CREM (NM_181571) Human Untagged Clone
CAT#: SC311180
CREM (untagged)-Human cAMP responsive element modulator (CREM), transcript variant 1
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CREM-2; hCREM-2; ICER |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC311180 representing NM_181571.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGCAAATGTGCAAGGAAAAAATATATTAAGACAAATCCAAGACAAATGACCATGGAAACAGTTGAA TCCCAGCATGATGGAAGTATAACAGCTTCTTTGACAGAGAGCAAGTCTGCTCATGTGCAGACTCAGACT GGCCAAAATTCAATCCCTGCTTTAGCTCAGGTAGCAGCAATTGCAGAGACAGATGAATCTGCAGAATCA GAAGGTGTAATTGATTCTCATAAACGTAGAGAAATCCTTTCACGAAGACCCTCTTATAGGAAAATACTG AATGAACTGTCCTCTGATGTGCCTGGTGTTCCCAAGATTGAAGAAGAGAGATCAGAGGAAGAAGGAACA CCACCTAGTATTGCTACCATGGCAGTACCAACTAGCATATATCAGACTAGCACGGGGCAATACATTGCT ATAGCCCAAGGTGGAACAATCCAGATTTCTAACCCAGGATCTGATGGTGTTCAGGGACTGCAGGCATTA ACAATGACAAATTCAGGAGCTCCTCCACCAGGTGCTACAATTGTACAGTACGCAGCACAATCAGCTGAT GGCACACAGCAGTTCTTTGTCCCAGGCAGCCAGGTTGTTGTTCAAGCTGCCACTGGTGACATGCCAACT TACCAGATCCGAGCTCCTACTGCTGCTTTGCCACAGGGAGTGGTGATGGCTGCATCGCCCGGAAGTTTG CACAGTCCCCAGCAGCTGGCAGAAGAAGCAACACGCAAACGAGAGCTGAGGCTAATGAAAAACAGGGAA GCTGCCAAAGAATGTCGACGTCGAAAGAAAGAATATGTAAAATGTCTGGAGAGCCGAGTTGCAGTGCTG GAAGTCCAGAACAAGAAGCTTATAGAGGAACTTGAAACCTTGAAAGACATTTGTTCTCCCAAAACAGAT TACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_181571 |
Insert Size | 903 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_181571.2 |
RefSeq Size | 2228 bp |
RefSeq ORF | 903 bp |
Locus ID | 1390 |
UniProt ID | Q03060 |
Protein Families | Druggable Genome, Transcription Factors |
MW | 32.5 kDa |
Gene Summary | This gene encodes a bZIP transcription factor that binds to the cAMP responsive element found in many viral and cellular promoters. It is an important component of cAMP-mediated signal transduction during the spermatogenetic cycle, as well as other complex processes. Alternative promoter and translation initiation site usage allows this gene to exert spatial and temporal specificity to cAMP responsiveness. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene, with some of them functioning as activators and some as repressors of transcription. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longest isoform (1). This isoform represents an activator tau2 isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215303 | CREM (Myc-DDK-tagged)-Human cAMP responsive element modulator (CREM), transcript variant 1 |
CNY 3990.00 |
|
RC215303L1 | Lenti ORF clone of Human cAMP responsive element modulator (CREM), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC215303L2 | Lenti ORF clone of Human cAMP responsive element modulator (CREM), transcript variant 1, mGFP tagged |
CNY 6000.00 |
|
RC215303L3 | Lenti ORF clone of Human cAMP responsive element modulator (CREM), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC215303L4 | Lenti ORF clone of Human cAMP responsive element modulator (CREM), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG215303 | CREM (tGFP-tagged) - Human cAMP responsive element modulator (CREM), transcript variant 1 |
CNY 5200.00 |