RHBDD2 (NM_001040456) Human Untagged Clone
CAT#: SC311174
RHBDD2 (untagged)-Human rhomboid domain containing 2 (RHBDD2), transcript variant 1
CNY 3656.00
CNY 7220.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | NPD007; RHBDL7 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001040456 edited
ATGGCGGCCTCGGGGCCCGGGTGTCGCAGCTGGTGCTTGTGTCCCGAGGTGCCATCCGCC ACCTTCTTCACTGCGCTGCTCTCGCTGCTGGTTTCCGGGCCTCGCCTGTTCCTGCTGCAG CAGCCCCTGGCGCCCTCGGGCCTCACGCTGAAGTCCGAGGCCCTTCGCAACTGGCAAGTT TACAGGCTGGTAACCTACATCTTTGTCTACGAGAATCCCATCTCCCTGCCCTGCGGCGCT ATCATCATCTGGCGCTTTGCTGGCAATTTCGAGAGAACCGTGGGCACCGTCCGCCACTGC TTCTTCACCGTGATCTTCGCCATCTTCTCCGCTATCATCTTCCTGTCATTCGAGGCTGTG TCATCACTGTCAAAGCTGGGGGAAGTGGAGGATGCCAGAGGTTTCACCCCAGTGGCCTTT GCCATGCTGGGAGTCACCACCGTCCGTTCTCGGATGAGGCGGGCCCTGGTGTTTGGCATG GTTGTGCCCTCAGTCCTGGTTCCGTGGCTCCTGCTGGGTGCCTCGTGGCTCATTCCCCAG ACCTCTTTCCTCAGTAATGTCTGCGGGCTGTCCATCGGGCTGGCCTATGGCCTCACCTAC TGCTATTCCATCGACCTCTCAGAGCGAGTGGCGCTGAAGCTCGATCAGACCTTCCCCTTC AGCCTGATGAGGAGGATATCCGTGTTCAAGTACGTCTCAGGGTCTTCAGCCGAGAGGAGG GCAGCCCAGAGCCGGAAACTGAACCCGGTGCCTGGCTCCTACCCCACACAGAGCTGCCAC CCTCACCTGTCCCCAAGCCACCCTGTGTCCCAGACGCAGCACGCCAGTGGTCAGAAGCTG GCCTCCTGGCCCTCCTGCACCCCCGGGCACATGCCCACCTTGCCTCCGTACCAGCCTGCC TCCGGCCTGTGCTATGTGCAGAACCACTTTGGTCCAAACCCCACCTCCTCCAGTGTCTAC CCAGCTTCTGCGGGCACCTCCCTGGGCATCCAGCCCCCCACGCCTGTGAACAGCCCTGGC ACGGTGTATTCTGGGGCCTTGGGCACACCAGGGGCTGCAGGCTCCAAGGAGTCCTCCAGG GTCCCCATGCCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001040456 |
Insert Size | 1100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001040456.1, NP_001035546.1 |
RefSeq Size | 1756 bp |
RefSeq ORF | 1095 bp |
Locus ID | 57414 |
UniProt ID | Q6NTF9 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is a member of the rhomboid family of membrane-bound proteases and is overexpressed in some breast cancers. Members of this family are involved in intramembrane proteolysis. In mouse, the orthologous protein associates with the Golgi body. [provided by RefSeq, Sep 2016] Transcript Variant: This variant (1) encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209659 | RHBDD2 (Myc-DDK-tagged)-Human rhomboid domain containing 2 (RHBDD2), transcript variant 1 |
CNY 3656.00 |
|
RC209659L3 | Lenti ORF clone of Human rhomboid domain containing 2 (RHBDD2), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC209659L4 | Lenti ORF clone of Human rhomboid domain containing 2 (RHBDD2), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG209659 | RHBDD2 (tGFP-tagged) - Human rhomboid domain containing 2 (RHBDD2), transcript variant 1 |
CNY 5256.00 |