SIRP alpha (SIRPA) (NM_001040023) Human Untagged Clone

CAT#: SC311081

SIRPA (untagged)-Human signal-regulatory protein alpha (SIRPA), transcript variant 2



  "NM_001040023" in other vectors (4)

CNY 7220.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
SIRPA mouse monoclonal antibody, clone OTI7B3 (formerly 7B3)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BIT; CD172A; MFR; MYD-1; P84; PTPNS1; SHPS1; SIRP
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001040023 edited
ATGGAGCCCGCCGGCCCGGCCCCCGGCCGCCTCGGGCCGCTGCTCTGCCTGCTGCTCGCC
GCGTCCTGCGCCTGGTCAGGAGTGGCGGGTGAGGAGGAGCTGCAGGTGATTCAGCCTGAC
AAGTCCGTGTTGGTTGCAGCTGGAGAGACAGCCACTCTGCGCTGCACTGCGACCTCTCTG
ATCCCTGTGGGGCCCATCCAGTGGTTCAGAGGAGCTGGACCAGGCCGGGAATTAATCTAC
AATCAAAAAGAAGGCCACTTCCCCCGGGTAACAACTGTTTCAGACCTCACAAAGAGAAAC
AACATGGACTTTTCCATCCGCATCGGTAACATCACCCCAGCAGATGCCGGCACCTACTAC
TGTGTGAAGTTCCGGAAAGGGAGCCCCGATGACGTGGAGTTTAAGTCTGGAGCAGGCACT
GAGCTGTCTGTGCGCGCCAAACCCTCTGCCCCCGTGGTATCGGGCCCTGCGGCGAGGGCC
ACACCTCAGCACACAGTGAGCTTCACCTGCGAGTCCCACGGCTTCTCACCCAGAGACATC
ACCCTGAAATGGTTCAAAAATGGGAATGAGCTCTCAGACTTCCAGACCAACGTGGACCCC
GTAGGAGAGAGCGTGTCCTACAGCATCCACAGCACAGCCAAGGTGGTGCTGACCCGCGAG
GACGTTCACTCTCAAGTCATCTGCGAGGTGGCCCACGTCACCTTGCAGGGGGACCCTCTT
CGTGGGACTGCCAACTTGTCTGAGACCATCCGAGTTCCACCCACCTTGGAGGTTACTCAA
CAGCCCGTGAGGGCAGAGAACCAGGTGAATGTCACCTGCCAGGTGAGGAAGTTCTACCCC
CAGAGACTACAGCTGACCTGGTTGGAGAATGGAAACGTGTCCCGGACAGAAACGGCCTCA
ACCGTTACAGAGAACAAGGATGGTACCTACAACTGGATGAGCTGGCTCCTGGTGAATGTA
TCTGCCCACAGGGATGATGTGAAGCTCACCTGCCAGGTGGAGCATGACGGGCAGCCAGCG
GTCAGCAAAAGCCATGACCTGAAGGTCTCAGCCCACCCGAAGGAGCAGGGCTCAAATACC
GCCGCTGAGAACACTGGATCTAATGAACGGAACATCTATATTGTGGTGGGTGTGGTGTGC
ACCTTGCTGGTGGCCCTACTGATGGCGGCCCTCTACCTCGTCCGAATCAGACAGAAGAAA
GCCCAGGGCTCCACTTCTTCTACAAGGTTGCATGAGCCCGAGAAGAATGCCAGAGAAATA
ACACAGGACACAAATGATATCACATATGCAGACCTGAACCTGCCCAAGGGGAAGAAGCCT
GCTCCCCAGGCTGCGGAGCCCAACAACCACACGGAGTATGCCAGCATTCAGACCAGCCCG
CAGCCCGCGTCGGAGGACACCCTCACCTATGCTGACCTGGACATGGTCCACCTCAACCGG
ACCCCCAAGCAGCCGGCCCCCAAGCCTGAGCCGTCCTTCTCAGAGTACGCCAGCGTCCAG
GTCCCGAGGAAGTGA
Restriction Sites Please inquire     
ACCN NM_001040023
Insert Size 2300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001040023.1, NP_001035112.1
RefSeq Size 4109 bp
RefSeq ORF 1515 bp
Locus ID 140885
UniProt ID P78324
Protein Families Druggable Genome, Phosphatase, Transmembrane
Gene Summary The protein encoded by this gene is a member of the signal-regulatory-protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. This protein can be phosphorylated by tyrosine kinases. The phospho-tyrosine residues of this PTP have been shown to recruit SH2 domain containing tyrosine phosphatases (PTP), and serve as substrates of PTPs. This protein was found to participate in signal transduction mediated by various growth factor receptors. CD47 has been demonstrated to be a ligand for this receptor protein. This gene and its product share very high similarity with several other members of the SIRP family. These related genes are located in close proximity to each other on chromosome 20p13. Multiple alternatively spliced transcript variants have been determined for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR and uses an alternate, in-frame, splice donor site in the 3' coding region compared to variant 4. This variant encodes a shorter protein (isoform 1) compared to isoform 2. Variants 1, 2, and 3 encode the same protein (isoform 1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...