ARL16 (NM_001040025) Human Untagged Clone
CAT#: SC311069
ARL16 (untagged)-Human ADP-ribosylation factor-like 16 (ARL16)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC311069 representing NM_001040025.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGAGTGGCCGGTGGGCGGGCCTTGAGCCGCGGCGCCGAGCTACGGGTGCCGGGTGGAGCGAAGCAC GGAATGTGTCTCCTGCTGGGGGCCACGGGCGTCGGGAAGACGCTGCTGGTGAAACGGCTGCAGGAGGTG AGCTCCCGGGATGGGAAAGGCGACCTGGGGGAGCCGCCCCCGACACGGCCCACGGTGGGCACCAATCTT ACTGACATCGTGGCACAGAGAAAGATCACCATCCGGGAGCTTGGGGGGTGCATGGGCCCCATCTGGTCC AGTTACTATGGAAACTGCCGTTCTCTCCTGTTTGTGATGGACGCCTCTGACCCCACCCAGCTCTCTGCA TCCTGTGTGCAGCTCTTAGGTCTCCTTTCTGCAGAACAACTTGCAGAAGCATCGGTGCTGATACTCTTC AATAAAATCGACCTACCCTGTTACATGTCCACGGAGGAGATGAAGTCATTAATCAGGCTTCCAGACATC ATTGCTTGTGCCAAGCAGAACATCACCACGGCAGAAATCAGCGCCCGTGAAGGCACTGGCTTAGCAGGG GTGCTGGCCTGGCTCCAGGCCACCCACAGAGCCAACGATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001040025 |
Insert Size | 594 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001040025.2 |
RefSeq Size | 1253 bp |
RefSeq ORF | 594 bp |
Locus ID | 339231 |
UniProt ID | Q0P5N6 |
MW | 20.9 kDa |
Gene Summary | The protein encoded by this gene belongs to the ARL (ADP-ribosylation factor-like) family of proteins, which are structurally related to ADP-ribosylation factors (ARFs). This protein has been shown to have an inhibitory role in the cellular antiviral response. This gene product interacts with the C-terminal domain of the DEXD/H-box helicase 58 (DDX58) gene product. This interaction was found to suppress the association between the DDX58 gene product and RNA, thereby negatively regulating the activity of the DDX58 gene product. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220484 | ARL16 (Myc-DDK-tagged)-Human ADP-ribosylation factor-like 16 (ARL16) |
CNY 2400.00 |
|
RC220484L3 | Lenti ORF clone of Human ADP-ribosylation factor-like 16 (ARL16), Myc-DDK-tagged |
CNY 5890.00 |
|
RC220484L4 | Lenti ORF clone of Human ADP-ribosylation factor-like 16 (ARL16), mGFP tagged |
CNY 5890.00 |
|
RG220484 | ARL16 (tGFP-tagged) - Human ADP-ribosylation factor-like 16 (ARL16) |
CNY 4000.00 |