SCN3B (NM_001040151) Human Untagged Clone

CAT#: SC310915

SCN3B (untagged)-Human sodium channel, voltage-gated, type III, beta (SCN3B), transcript variant 2



  "NM_001040151" in other vectors (4)

CNY 3990.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal Anti-SCN3B Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ATFB16; BRGDA7; HSA243396; SCNB3
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001040151 edited
ATGCCTGCCTTCAATAGATTGTTTCCCCTGGCTTCTCTCGTGCTTATCTACTGGGTCAGT
GTCTGCTTCCCTGTGTGTGTGGAAGTGCCCTCGGAGACGGAGGCCGTGCAGGGCAACCCC
ATGAAGCTGCGCTGCATCTCCTGCATGAAGAGAGAGGAGGTGGAGGCCACCACGGTGGTG
GAATGGTTCTACAGGCCCGAGGGCGGTAAAGATTTCCTTATTTACGAGTATCGGAATGGC
CACCAGGAGGTGGAGAGCCCCTTTCAGGGGCGCCTGCAGTGGAATGGCAGCAAGGACCTG
CAGGACGTGTCCATCACTGTGCTCAACGTCACTCTGAACGACTCTGGCCTCTACACCTGC
AATGTGTCCCGGGAGTTTGAGTTTGAGGCGCATCGGCCCTTTGTGAAGACGACGCGGCTG
ATCCCCCTAAGAGTCACCGAGGAGGCTGGAGAGGACTTCACCTCTGTGGTCTCAGAAATC
ATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGC
TACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCC
ATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAG
Restriction Sites Please inquire     
ACCN NM_001040151
Insert Size 1600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001040151.1, NP_001035241.1
RefSeq Size 5682 bp
RefSeq ORF 648 bp
Locus ID 55800
UniProt ID Q9NY72
Protein Families Druggable Genome, Ion Channels: Sodium, Transmembrane
Gene Summary Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel beta subunit gene family, and influences the inactivation kinetics of the sodium channel. Two alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...