SLC25A29 (NM_001039355) Human Untagged Clone

CAT#: SC310895

SLC25A29 (untagged)-Human solute carrier family 25, member 29 (SLC25A29), nuclear gene encoding mitochondrial protein



  "NM_001039355" in other vectors (4)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-SLC25A29 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C14orf69; CACL; ORNT3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310895 representing NM_001039355.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCTGGACTTCTTGGCTGGATGCGCGGGGGGTGTGGCAGGCGTGCTTGTGGGACACCCGTTTGAC
ACGGTCAAGGTACGGCTTCAGGTCCAGAGCGTGGAGAAGCCTCAGTACCGCGGGACGTTGCACTGCTTC
AAGTCCATCATCAAGCAAGAGAGCGTGCTGGGCCTGTACAAGGGCCTGGGCTCGCCGCTCATGGGGCTC
ACCTTCATCAACGCGCTGGTGTTCGGGGTGCAGGGCAACACCCTCCGGGCCCTGGGCCACGACTCGCCC
CTCAACCAGTTCCTGGCAGGTGCGGCGGCGGGCGCCATCCAGTGCGTCATCTGCTGCCCCATGGAGCTG
GCCAAGACGCGGCTGCAGCTGCAGGACGCGGGCCCAGCGCGCACCTACAAGGGCTCGCTGGACTGCCTC
GCGCAGATCTACGGGCACGAGGGTCTGCGTGGCGTCAACCGGGGCATGGTGTCCACGTTGCTGCGTGAG
ACGCCCAGCTTCGGCGTCTACTTCCTCACCTATGACGCTCTCACGCGGGCGCTGGGCTGCGAGCCGGGC
GACCGCCTGCTGGTGCCCAAGCTGCTGTTGGCGGGCGGTACGTCAGGCATCGTGTCCTGGCTCTCTACC
TATCCTGTGGACGTGGTCAAGTCGCGGCTGCAGGCGGACGGACTGCGGGGCGCCCCGCGCTACCGCGGC
ATCCTGGACTGCGTGCACCAGAGCTACCGCGCCGAGGGCTGGCGCGTCTTCACACGGGGGCTGGCGTCC
ACGCTGCTGCGCGCCTTCCCCGTCAACGCTGCCACCTTCGCCACCGTCACGGTGGTGCTCACCTACGCG
CGCGGCGAGGAGGCCGGGCCCGAGGGCGAGGCTGTGCCCGCCGCCCCTGCGGGGCCTGCCCTGGCGCAG
CCCTCCAGCCTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001039355
Insert Size 912 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001039355.2
RefSeq Size 2417 bp
RefSeq ORF 912 bp
Locus ID 123096
UniProt ID Q8N8R3
Protein Families Druggable Genome
MW 32.1 kDa
Gene Summary This gene encodes a nuclear-encoded mitochondrial protein that is a member of the large family of solute carrier family 25 (SLC25) mitochondrial transporters. The members of this superfamily are involved in numerous metabolic pathways and cell functions. This gene product was previously reported to be a mitochondrial carnitine-acylcarnitine-like (CACL) translocase (PMID:128829710) or an ornithine transporter (designated ORNT3, PMID:19287344), however, a recent study characterized the main role of this protein as a mitochondrial transporter of basic amino acids, with a preference for arginine and lysine (PMID:24652292). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (1) encodes isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...