ELMO1 (NM_001039459) Human Untagged Clone

CAT#: SC310877

ELMO1 (untagged)-Human engulfment and cell motility 1 (ELMO1), transcript variant 3



  "NM_001039459" in other vectors (6)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ELMO1 Rabbit monoclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CED-12; CED12; ELMO-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310877 representing NM_001039459.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGGTGGTGAAGGAGCAGGTTATGAGAGCACTTACAACCAAGCCTAGCTCCCTGGACCAGTTCAAG
AGCAAACTGCAGAACCTGAGCTACACTGAGATCCTGAAAATCCGCCAGTCCGAGAGGATGAACCAGGAA
GATTTCCAGTCCCGCCCGATTTTGGAACTAAAGGAGAAGATTCAGCCAGAAATCTTAGAGCTGATCAAA
CAGCAACGCCTGAACCGCCTTGTGGAAGGGACCTGCTTTAGGAAACTCAATGCCCGGCGGAGGCAAGAC
AAGTTTTGGTATTGTCGGCTTTCGCCAAATCACAAAGTCCTGCATTACGGAGACTTAGAAGAGAGTCCT
CAGGGAGAAGTGCCCCACGATTCCTTGCAGGACAAACTGCCGGTGGCAGATATCAAAGCCGTGGTGACG
GGAAAGGACTGCCCTCATATGAAAGAGAAAGGTGCCCTTAAACAAAACAAGGAGGTGCTTGAACTCGCT
TTCTCCATCTTGTATGACTCAAACTGCCAACTGAACTTCATCGCTCCTGACAAGCATGAGTACTGTATC
TGGACGGATGGACTGAATGCGCTACTCGGGAAGGACATGATGAGCGACCTGACGCGGAATGACCTGGAC
ACCCTGCTCAGCATGGAAATCAAGCTCCGCCTCCTGGACCTGGAAAACATCCAGATCCCTGACGCACCT
CCGCCGATTCCCAAGGAGCCCAGCAACTATGACTTCGTCTATGACTGTAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001039459
Insert Size 744 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001039459.2
RefSeq Size 3590 bp
RefSeq ORF 744 bp
Locus ID 9844
UniProt ID Q92556
Protein Pathways Chemokine signaling pathway
MW 28.7 kDa
Gene Summary This gene encodes a member of the engulfment and cell motility protein family. These proteins interact with dedicator of cytokinesis proteins to promote phagocytosis and cell migration. Increased expression of this gene and dedicator of cytokinesis 1 may promote glioma cell invasion, and single nucleotide polymorphisms in this gene may be associated with diabetic nephropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (3) represents use of an alternate promoter and differs in the 5' UTR and 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 1. Both variants 2 and 3 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...