BOLA2B (NM_001039182) Human Untagged Clone
CAT＃: SC310857
BOLA2B (untagged)-Human bolA homolog 2B (E. coli) (BOLA2B)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BOLA2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC310857 representing NM_001039182.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCAAGCGCGAAAAGCCTGGACCGCTGGAAAGCCCGGCTGCTTGAGGGCGGAAGTACTGCGTTGACG TACGCCTTAGTAAGGGCGGAAGTGAGTTTTCCAGCGGAAGTGGCTCCTGTAAGGCAGCAAGGTAGCGTG GCCGGCGCCCGAGCTGGGGTTGTGTCCCTGCTGGGCTGCCGTTCCAGCTGGACTGCCGCCATGGAACTC AGCGCCGAATACCTCCGCGAGAAGCTGCAGCGGGACCTGGAGGCGGAGCATGTGGAGGTGGAGGACACG ACCCTCAACCGTTGCTCCTGTAGCTTCCGAGTCCTGGTGGTGTCGGCCAAGTTCGAGGGGAAACCGCTG CTTCAGAGACACAGGCTGGTGAACGCGTGCCTAGCAGAAGAGCTCCCGCACATCCATGCCTTTGAACAG AAAACCCTGACCCCAGACCAGTGGGCACGTGAGCGACAGAAATGA AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT ATCCTGGATTACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-RsrII |
| ACCN | NM_001039182 |
| Insert Size | 459 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001039182.2 |
| RefSeq Size | 1017 bp |
| RefSeq ORF | 459 bp |
| Locus ID | 654483 |
| UniProt ID | Q9H3K6 |
| MW | 16.9 kDa |
| Gene Summary | This gene is located within a region of a segmental duplication on chromosome 16 and is identical to BOLA2 (bolA family member 2). The product of this gene belongs to a family of proteins that are widely conserved and may be involved in iron maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). CCDS Note: This CCDS was updated to trim the coding region at the 5' end, which reduces the protein size to 86aa. The update is supported by conservation and proteomics data. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220662 | BOLA2B (Myc-DDK-tagged)-Human bolA homolog 2B (E. coli) (BOLA2B) |
CNY 1200.00 |
|
| RC220662L3 | Lenti ORF clone of Human bolA homolog 2B (E. coli) (BOLA2B), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC220662L4 | Lenti ORF clone of Human bolA homolog 2B (E. coli) (BOLA2B), mGFP tagged |
CNY 5890.00 |
|
| RG220662 | BOLA2B (tGFP-tagged) - Human bolA homolog 2B (E. coli) (BOLA2B) |
CNY 4370.00 |
