RGS21 (NM_001039152) Human Untagged Clone
CAT#: SC310854
RGS21 (untagged)-Human regulator of G-protein signaling 21 (RGS21)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC310854 representing NM_001039152.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCAGTGAAATGCTGTTTCTACAGGTCACCAACTGCGGAAACAATGACATGGTCTGAAAATATGGAC ACGCTTTTAGCCAACCAAGCTGGTCTAGATGCTTTTCGAATATTTCTAAAATCAGAGTTTAGTGAAGAA AATGTTGAGTTCTGGCTTGCCTGTGAAGACTTTAAGAAAACGAAAAATGCAGACAAAATTGCTTCCAAA GCCAAGATGATTTATTCTGAATTCATTGAAGCTGATGCACCTAAAGAGATTAACATTGACTTCGGTACC AGAGACCTCATCTCAAAGAATATTGCTGAACCAACACTCAAATGCTTTGATGAGGCTCAGAAATTAATC TATTGTCTCATGGCCAAGGATTCTTTCCCTCGATTTCTGAAGTCAGAGATTTATAAAAAACTGGTAAAT AGCCAACAGGTTCCAAATCATAAAAAATGGCTCCCTTTTTTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001039152 |
Insert Size | 459 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001039152.3 |
RefSeq Size | 1794 bp |
RefSeq ORF | 459 bp |
Locus ID | 431704 |
UniProt ID | Q2M5E4 |
MW | 17.7 kDa |
Gene Summary | Regulator of G protein signaling (RGS) proteins are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins are GTPase-activating proteins for Gi (see GNAI1; MIM 139310) and Gq (see GNAQ; MIM 600998) class G-alpha proteins. They accelerate transit through the cycle of GTP binding and hydrolysis and thereby accelerate signaling kinetics and termination.[supplied by OMIM, Nov 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211440 | RGS21 (Myc-DDK-tagged)-Human regulator of G-protein signaling 21 (RGS21) |
CNY 1200.00 |
|
RC211440L3 | Lenti ORF clone of Human regulator of G-protein signaling 21 (RGS21), Myc-DDK-tagged |
CNY 5890.00 |
|
RC211440L4 | Lenti ORF clone of Human regulator of G-protein signaling 21 (RGS21), mGFP tagged |
CNY 5890.00 |
|
RG211440 | RGS21 (tGFP-tagged) - Human regulator of G-protein signaling 21 (RGS21) |
CNY 4370.00 |