CHTF8 (NM_001039690) Human Untagged Clone
CAT#: SC310815
CHTF8 (untagged)-Human CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae) (CHTF8), transcript variant 1
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CTF8; DERPC |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC310815 representing NM_001039690.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTGCAAATTGTTATTTCCAGTGCGAGGGCTGGAGGCCTGGCAGAATGGGTGCTGATGGAGCTACAG GGGGAGATCGAGGCTCGCTACAGCACTGGATTAGCTGGAAACCTCCTGGGAGACCTACATTACACCACT GAGGGAATCCCTGTGCTGATCGTGGGGCATCATATCCTGTATGGGAAAATCATCCACCTGGAGAAACCT TTTGCAGTCCTTGTCAAACACACTCCTGGGGATCAGGACTGTGATGAGCTTGGCCGCGAGACTGGCACC CGGTACCTGGTGACAGCACTCATCAAAGACAAGATCCTTTTCAAAACCCGCCCCAAGCCCATTATCACC AGCGTCCCCAAGAAAGTATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001039690 |
| Insert Size | 366 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001039690.3 |
| RefSeq Size | 2934 bp |
| RefSeq ORF | 366 bp |
| Locus ID | 54921 |
| UniProt ID | P0CG13 |
| MW | 13.3 kDa |
| Gene Summary | This gene encodes a short protein that forms part of the Ctf18 replication factor C (RFC) complex that occurs in both yeast and mammals. The heteroheptameric RFC complex plays a role in sister chromatid cohesion and may load the replication clamp PCNA (proliferating cell nuclear antigen) onto DNA during DNA replication and repair. This gene is ubiquitously expressed and has been shown to have reduced expression in renal and prostate tumors. Alternatively spliced transcript variants have been described. This gene has a pseudogene on chromosome X. [provided by RefSeq, Oct 2018] Transcript Variant: This variant (1) represents the longer transcript. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222566 | CHTF8 (Myc-DDK-tagged)-Human CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae) (CHTF8), transcript variant 1 |
CNY 1200.00 |
|
| RC222566L3 | Lenti ORF clone of Human CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae) (CHTF8), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC222566L4 | Lenti ORF clone of Human CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae) (CHTF8), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG222566 | CHTF8 (tGFP-tagged) - Human CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae) (CHTF8), transcript variant 1 |
CNY 2800.00 |
